Blast-Radius Aware AI Code Review for Business-Critical Systems
LiveReview LiveReview Explore LiveReview

Bio::Graphics::Browser2::Realign - Perl extension for Smith-Waterman alignments

Author

       Lincoln Stein <lstein@cshl.org>.

       Copyright (c) 2003 Cold Spring Harbor Laboratory

       This  library  is  free  software;  you can redistribute it and/or modify it under the same terms as Perl
       itself.  See DISCLAIMER.txt for disclaimers of warranty.

Description

       This is a helper utility used by gbrowse to produce global alignments.  It uses slow Smith-Waterman, so
       is only appropriate for short segments that are mostly aligned already.

       It can be speeded up significantly by compiling Bio::Graphics::Browser2::CAlign, an XS extension.  To do
       this, build gbrowse with the DO_XS=1 option:

         cd Generic-Genome-Browser
         perl Makefile.PL DO_XS=1

   METHODS
       $aligner = Bio::Graphics::Browser2::Realign->new($src,$target [,\%matrix])
           The  new()  method  takes  two  the two sequence strings to be aligned and an optional weight matrix.
           Legal weight matrix keys and their default values are shown here:

              Key name       Default       Description
              --------       -------       -----------

              match            1           Award one point for an exact match.
              mismatch        -1           Penalize one point for a mismatch.
              wildcard_match   0           No penalty for a match to a wildcard (e.g. "n").
              gap             -1           Penalize one point to create a gap.
              gap_extend       0           No penalty for extending an existing gap.
              wildcard         'N'         The wildcard character.

           The alignment algorithm is run when new() is called.

       $score = $aligner->score
           Return the score from the alignment.

       $start = $aligner->start
           Return the start of the aligned region, in source sequence coordinates.

       $end = $aligner->end
           Return the end of the aligned region, in source sequence coordinates.

       $arrayref = $aligner->alignment
           Return an arrayref representing the alignment.  The array will be  exactly  as  long  as  the  source
           sequence.   Its  indexes correspond to positions on the source sequence, and its values correspond to
           positions on the target sequence.  An unaligned base is indicated as undef.  Indexes are zero-based.

           For example, this alignment:

             gatttttt--c
             ||||||    |
             gatttt--ccc

           corresponds to this arrayref:

              index    value
              0[g]    0[g]
              1[a]    1[a]
              2[t]    2[t]
              3[t]    3[t]
              4[t]    4[t]
              5[t]    5[t]
              6[t]    undef
              7[t]    undef
              8[c]    8[c]

       ($top,$middle,$bottom) = $aligner->pads
           Returns the alignment as three padded strings indicating the  top,  middle  and  bottom  lines  of  a
           pretty-printed representation.

           For example:

             print join "\n",$aligner->pads;

           Will produce this output:

             gatttttt--c
             ||||||    |
             gatttt--ccc

   EXPORTEDMETHODS
       No functions are exported by default, but the following two methods can be imported explicitly.

       ($top,$middle,$bottom) = align($source,$target [,\%matrix])
           Align  the  source and target sequences and return the padded strings representing the alignment.  It
           is exactly equivalent to calling:

             Bio::Graphics::Browser2::Realign->new($source,$target)->pads;

       $segs_arrayref = align_segs($source,$target [,\%matrix])
           The align_segs() function aligns $source and $target and returns an  array  of  non-gapped  segments.
           Each   element  of  the  array  corresponds  to  a  contiguous  nongapped  alignment  in  the  format
           [src_start,src_end,tgt_start,tgt_end].

           This is useful for converting a gapped alignment into a series of nongapped alignments.

           In a list context this function will return a list of non-gapped segments.

       $segs_arrayref = Bio::Graphics::Browser2::Realign->pads_to_segments($seq1,$pads,$seq2)
           This class method takes two padded sequence strings and the alignment string that  relates  them  and
           returns an array ref of non-gapped aligned sequence in the format:

             [src_start,src_end,tgt_start,tgt_end]

           The 3 strings look like this CA-ACCCCCTTGCAACAACCTTGAGAACCCCAGGGA
                                        | |||||||||||||||||||||||||||||||||
                                        AAGACCCCCTTGCAACAACCTTGAGAACCCCAGGGA

Name

       Bio::Graphics::Browser2::Realign - Perl extension for Smith-Waterman alignments

See Also

       Bio::Graphics::Browser.

perl v5.40.0                                       2024-10-20              Bio::Graphics::Browser2::Realign(3pm)

Synopsis

         use Bio::Graphics::Browser2::Realign 'align';
         my ($top,$middle,$bottom) = align('gattttttc','gattttccc');
         print join "\n",$top,$middle,$bottom,"\n";

         # produces:
         gatttttt--c
         ||||||    |
         gatttt--ccc

See Also