logo
Free, Micro AI Code Reviews That Run on Git Commit
git-lrc git-lrc GitHub Install Now We'd appreciate a star git-lrc - Free, Micro AI Code Reviews That Run on Git Commit | Product Hunt git-lrc - Free, Micro AI Code Reviews That Run on Git Commit | Product Hunt

Bio::SeqFeature::Amplicon - Amplicon feature

Appendix

       The rest of the documentation details each of the object methods. Internal methods are usually preceded
       with a _

   new
        Title   : new()
        Usage   : my $amplicon = Bio::SeqFeature::Amplicon( -seq => $seq_object );
        Function: Instantiate a new Bio::SeqFeature::Amplicon object
        Args    : -seq        , the sequence object or sequence string of the amplicon (optional)
                  -fwd_primer , a Bio::SeqFeature primer object with specified location on amplicon (optional)
                  -rev_primer , a Bio::SeqFeature primer object with specified location on amplicon (optional)
        Returns : A Bio::SeqFeature::Amplicon object

   fwd_primer
        Title   : fwd_primer
        Usage   : my $primer = $feat->fwd_primer();
        Function: Get or set the forward primer. When setting it, the primary tag
                  'fwd_primer' is added to the primer and its start, stop and strand
                  attributes are set if needed, assuming that the forward primer is
                  at the beginning of the amplicon and the reverse primer at the end.
        Args    : A Bio::SeqFeature::Primer object (optional)
        Returns : A Bio::SeqFeature::Primer object

   rev_primer
        Title   : rev_primer
        Usage   : my $primer = $feat->rev_primer();
        Function: Get or set the reverse primer. When setting it, the primary tag
                 'rev_primer' is added to the primer.
        Args    : A Bio::SeqFeature::Primer object (optional)
        Returns : A Bio::SeqFeature::Primer object

perl v5.32.1                                       2021-08-15                     Bio::SeqFeature::Amplicon(3pm)

Author

       Florent Angly <florent.angly@gmail.com>

Description

       Bio::SeqFeature::Amplicon extends Bio::SeqFeature::Subseq to represent an amplicon sequence and optional
       primer sequences.

Feedback

MailingLists
       User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments
       and suggestions preferably to one of the Bioperl mailing lists.  Your participation is much appreciated.

         bioperl-l@bioperl.org                  - General discussion
         http://bioperl.org/wiki/Mailing_lists  - About the mailing lists

   Support
       Please direct usage questions or support issues to the mailing list:

       bioperl-l@bioperl.org

       rather than to the module maintainer directly. Many experienced and reponsive experts will be able look
       at the problem and quickly address it. Please include a thorough description of the problem with code and
       data examples if at all possible.

   ReportingBugs
       Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution.  Bug
       reports can be submitted via the web:

         https://github.com/bioperl/bioperl-live/issues

Name

       Bio::SeqFeature::Amplicon - Amplicon feature

Synopsis

         # Amplicon with explicit sequence
         use Bio::SeqFeature::Amplicon;
         my $amplicon = Bio::SeqFeature::Amplicon->new(
             -seq        => $seq_object,
             -fwd_primer => $primer_object_1,
             -rev_primer => $primer_object_2,
         );

         # Amplicon with implicit sequence
         use Bio::Seq;
         my $template = Bio::Seq->new( -seq => 'AAAAACCCCCGGGGGTTTTT' );
         $amplicon = Bio::SeqFeature::Amplicon->new(
             -start => 6,
             -end   => 15,
         );
         $template->add_SeqFeature($amplicon);
         print "Amplicon start   : ".$amplicon->start."\n";
         print "Amplicon end     : ".$amplicon->end."\n";
         print "Amplicon sequence: ".$amplicon->seq->seq."\n";
         # Amplicon sequence should be 'CCCCCGGGGG'

See Also