logo
Free, unlimited AI code reviews that run on commit
git-lrc git-lrc GitHub Install Now We'd appreciate a star git-lrc - Free, unlimited AI code reviews that run on commit | Product Hunt git-lrc - Free, unlimited AI code reviews that run on commit | Product Hunt

Bio::SeqFeature::Primer - Primer Generic SeqFeature

Appendix

       The rest of the documentation details each of the object methods. Internal methods are usually preceded
       with a _

   new()
        Title   : new()
        Usage   : my $primer = Bio::SeqFeature::Primer( -seq => $seq_object );
        Function: Instantiate a new Bio::SeqFeature::Primer object
        Returns : A Bio::SeqFeature::Primer object
        Args    : -seq , a sequence object or a sequence string (optional)
                  -id  , the ID to give to the primer sequence, not feature (optional)

   Tm()
        Title   : Tm()
        Usage   : my $tm = $primer->Tm(-salt => 0.05, -oligo => 0.0000001);
        Function: Calculate the Tm (melting temperature) of the primer
        Returns : A scalar containing the Tm.
        Args    : -salt  : set the Na+ concentration on which to base the calculation
                           (default=0.05 molar).
                : -oligo : set the oligo concentration on which to base the
                           calculation (default=0.00000025 molar).
        Notes   : Calculation of Tm as per Allawi et. al Biochemistry 1997
                  36:10581-10594. Also see documentation at
                  http://www.idtdna.com/Scitools/Scitools.aspx as they use this
                  formula and have a couple nice help pages. These Tm values will be
                  about are about 0.5-3 degrees off from those of the idtdna web tool.
                  I don't know why.

                  This was suggested by Barry Moore (thanks!). See the discussion on
                  the bioperl-l with the subject "Bio::SeqFeature::Primer Calculating
                  the PrimerTM"

   Tm_estimate
        Title   : Tm_estimate
        Usage   : my $tm = $primer->Tm_estimate(-salt => 0.05);
        Function: Estimate the Tm (melting temperature) of the primer
        Returns : A scalar containing the Tm.
        Args    : -salt set the Na+ concentration on which to base the calculation.
        Notes   : This is only an estimate of the Tm that is kept in for comparative
                  reasons. You should probably use Tm instead!

                  This Tm calculations are taken from the Primer3 docs: They are
                  based on Bolton and McCarthy, PNAS 84:1390 (1962)
                  as presented in Sambrook, Fritsch and Maniatis,
                  Molecular Cloning, p 11.46 (1989, CSHL Press).

                  Tm = 81.5 + 16.6(log10([Na+])) + .41*(%GC) - 600/length

                  where [Na+] is the molar sodium concentration, %GC is the
                  %G+C of the sequence, and length is the length of the sequence.

                  However.... I can never get this calculation to give me the same result
                  as primer3 does. Don't ask why, I never figured it out. But I did
                  want to include a Tm calculation here because I use these modules for
                  other things besides reading primer3 output.

                  The primer3 calculation is saved as 'PRIMER_LEFT_TM' or 'PRIMER_RIGHT_TM'
                  and this calculation is saved as $primer->Tm so you can get both and
                  average them!

   primary_tag,source_tag,location,start,end,strand...
       The documentation of Bio::SeqFeature::Generic describes all the methods that Bio::SeqFeature::Primer
       object inherit.

perl v5.32.1                                       2021-08-15                       Bio::SeqFeature::Primer(3pm)

Author

       Rob Edwards, redwards@utmem.edu

       The original concept and much of the code was written by Chad Matsalla, bioinformatics1@dieselwurks.com

Description

       This module handles PCR primer sequences. The Bio::SeqFeature::Primer object is a Bio::SeqFeature::Subseq
       object that can additionally contain a primer sequence and its coordinates on a template sequence. The
       primary_tag() for this object is 'Primer'. A method is provided to calculate the melting temperature Tm
       of the primer. Bio::SeqFeature::Primer objects are useful to build Bio::Seq::PrimedSeq amplicon objects
       such as the ones returned by Bio::Tools::Primer3.

Feedback

MailingLists
       User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments
       and suggestions preferably to one of the Bioperl mailing lists.  Your participation is much appreciated.

         bioperl-l@bioperl.org                  - General discussion
         http://bioperl.org/wiki/Mailing_lists  - About the mailing lists

   Support
       Please direct usage questions or support issues to the mailing list:

       bioperl-l@bioperl.org

       rather than to the module maintainer directly. Many experienced and reponsive experts will be able look
       at the problem and quickly address it. Please include a thorough description of the problem with code and
       data examples if at all possible.

   ReportingBugs
       Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution.  Bug
       reports can be submitted via the web:

         https://github.com/bioperl/bioperl-live/issues

Name

       Bio::SeqFeature::Primer - Primer Generic SeqFeature

Synopsis

         use Bio::SeqFeature::Primer;

         # Primer object with explicitly-defined sequence object or sequence string
         my $primer = Bio::SeqFeature::Primer->new( -seq => 'ACGTAGCT' );
         $primer->display_name('test_id');
         print "These are the details of the primer:\n".
               "Name:     ".$primer->display_name."\n".
               "Tag:      ".$primer->primary_tag."\n".   # always 'Primer'
               "Sequence: ".$primer->seq->seq."\n".
               "Tm:       ".$primer->Tm."\n\n";            # melting temperature

         # Primer object with implicit sequence object
         # It is a lighter approach for when the primer location on a template is known
         use Bio::Seq;
         my $template = Bio::Seq->new( -seq => 'ACGTAGCTCTTTTCATTCTGACTGCAACG' );
         $primer   = Bio::SeqFeature::Primer->new( -start => 1, -end =>5, -strand => 1 );
         $template->add_SeqFeature($primer);
         print "Primer sequence is: ".$primer->seq->seq."\n";
         # Primer sequence is 'ACGTA'

See Also