The rest of the documentation details each of the object methods. Internal methods are usually preceded
with a _
new
Title : new
Usage : my $obj = Bio::Tools::Run::StandAloneBlast->new();
Function: Builds a newBio::Tools::Run::StandAloneBlast object
Returns : Bio::Tools::Run::StandAloneBlast
Args : -quiet => boolean # make program execution quiet
-_READMETHOD => 'BLAST' (default, synonym 'SearchIO') || 'blast_pull'
# the parsing method, case insensitive
Essentially all BLAST parameters can be set via StandAloneBlast.pm. Some of the most commonly used
parameters are listed below. All parameters have defaults and are optional except for -p.
-p Program Name [String]
Input should be one of "wublastp", "wublastn", "wublastx",
"wutblastn", or "wutblastx".
-d Database [String] default = nr
The database specified must first be formatted with xdformat.
-E Expectation value (E) [Real] default = 10.0
-o BLAST report Output File [File Out] Optional,
default = ./blastreport.out ; set by StandAloneBlast.pm
wublast
Title : wublast
Usage : $blast_report = $factory->wublast('t/testquery.fa');
or
$input = Bio::Seq->new(-id=>"test query",
-seq=>"ACTACCCTTTAAATCAGTGGGGG");
$blast_report = $factory->wublast($input);
or
$seq_array_ref = \@seq_array; # where @seq_array is an array of Bio::Seq objects
$blast_report = $factory->wublast(\@seq_array);
Returns : Reference to a Blast object
Args : Name of a file or Bio::Seq object or an array of
Bio::Seq object containing the query sequence(s).
Throws an exception if argument is not either a string
(eg a filename) or a reference to a Bio::Seq object
(or to an array of Seq objects). If argument is string,
throws exception if file corresponding to string name can
not be found.
_generic_local_wublast
Title : _generic_local_wublast
Usage : internal function not called directly
Returns : Blast object
Args : Reference to calling object and name of BLAST executable
_runwublast
Title : _runwublast
Usage : Internal function, not to be called directly
Function: makes actual system call to WU-Blast program
Example :
Returns : Report Blast object
Args : Reference to calling object, name of BLAST executable,
and parameter string for executable
_setparams
Title : _setparams
Usage : Internal function, not to be called directly
Function: Create parameter inputs for Blast program
Example :
Returns : parameter string to be passed to Blast
Args : Reference to calling object and name of BLAST executable
perl v5.34.0 2022-02-10 Bio::Tools::Run...andAloneWUBlast(3pm)