Blast-Radius Aware AI Code Review for Business-Critical Systems
LiveReview LiveReview Explore LiveReview

tqs - Trim Quality Solexa-Illumina Sequences

Authors

       This manual page was written by Andreas Tille <tille@debian.org> for the Debian system (but may  be  used
       by others).  Permission is granted to copy, distribute and/or modify this document under the terms of the
       GNU General Public License, Version 2 any later version published by the Free Software Foundation.

       On Debian systems, the complete text of the GNU General Public License can be found in /usr/share/common-
       licenses/GPL.

                                                  January 2008                                            TQS(1)

Name

       tqs - Trim Quality Solexa-Illumina Sequences

Options

       -h, --help
                 show this help message and exit

       -f SEQFILE, --sequence file=SEQFILE
                 Illumina sequence file - Output format from the 1G Genome Analyzer (_seq.txt):
                     7       1       255     669
                     AACCCCCACTCCTACAACGCCATCATTCCCCTCGAC

       -q QUALFILE, --qual file=QUALFILE
                 A  prb  file  containing  all  the Illumina intensities, as outputted by the 1G Genome Analyzer
                 (_prb.txt)

       -l MER, --length=MER
                 Length of sequence reads (i.e. Number of sequencing cycles, default=36)

       -t THRESHOLD, --threshold=THRESHOLD
                 Base intensity threshold value (-40 to 40, default=5)

       -d DIFF, --difference=DIFF
                 Base intensity difference between top intensity and second best (1 to 80, default=5)

       -c CONSEC, --consec=CONSEC
                 Minimum number of consecutive bases passing threshold values (default=20)

       -v, --verbose
                 Runs in Verbose mode.

See Also

       /usr/share/doc/ssake/TQS.readme

Synopsis

       Quality trim solexa-Illumina sequence reads using user-defined thresholds.

See Also