sambamba-view - tool for extracting information from SAM/BAM files
Contents
Description
sambambaview allows to efficiently filter SAM/BAM files for alignments satisfying various conditions, as
well as access its SAM header and information about reference sequences. In order to make these data
readily available for consumption by scripts in Perl/Python/Ruby, JSON output is provided.
By default, the tool expects BAM file as an input. In order to work with SAM, specify -S|--sam-input as a
command-line option, the tool does NOT try to guess file format from the extension. Beware that when
reading SAM, the tool will skip tags which don´t conform to the SAM/BAM specification, and set invalid
fields to their default values.
Examples
Print basic reference sequence information:
$ sambamba view --reference-info ex1_header.bam
[{"name":"chr1","length":1575},{"name":"chr2","length":1584}]
Count reads with mapping quality not less than 50:
$ sambamba view -c -F "mapping_quality >= 50" ex1_header.bam
3124
Count properly paired reads overlapping 100..200 on chr1:
$ sambamba view -c -F "proper_pair" ex1_header.bam chr1:100-200
39
Output header in JSON format:
$ sambamba view --header --format=json ex1_header.bam
{"format_version":"1.3","rg_lines":[],
"sq_lines":[{"sequence_length":1575,"species":"","uri":"",
"sequence_name":"chr1","assembly":"","md5":""},
{"sequence_length":1584,"species":"","uri":"",
"sequence_name":"chr2","assembly":"","md5":""}],
"sorting_order":"coordinate","pg_lines":[]}
Filtering
Filtering is presented in two ways. First, you can specify a condition with -F option, using a special
language for filtering, described at
https://github.com/lomereiter/sambamba/wiki/%5Bsambamba-view%5D-Filter-expression-syntax
Second, if you have an indexed BAM file, several regions can be specified as well. The syntax for regions
is the same as in samtools: chr:beg-end where beg and end are 1-based start and end of a closed-end
interval on the reference chr.
Json
Alignment record JSON representation is a hash with keys ´qname´, ´flag´, ´rname´, ´pos´, ´mapq´,
´cigar´, ´rnext´, ´qual´, ´tags´, e.g.
{"qname":"EAS56_57:6:190:289:82","flag":69,"rname":"chr1","pos":100,
"mapq":0,"cigar":"*","rnext":"=","pnext":100,"tlen":0,
"seq":"CTCAAGGTTGTTGCAAGGGGGTCTATGTGAACAAA",
"qual":[27,27,27,22,27,27,27,26,27,27,27,27,27,27,27,27,23,26,26,27,
22,26,19,27,26,27,26,26,26,26,26,24,19,27,26],"tags":{"MF":192}}
JSON representation mimics SAM format except quality is given as an array of integers.
Postprocessing JSON output is best accomplished with https://stedolan.github.io/jq/
The output is one line per read, for building a proper JSON array pipe the output into jq--slurp.
Name
sambamba-view - tool for extracting information from SAM/BAM files
Options
-F, --filter=FILTER
Set custom filter for alignments.
-f, --format=FORMAT
Specify output format. FORMAT must be one of sam, bam, or json (in lowercase). Default is SAM.
-h, --with-header
Print SAM header before reads. This is always done for BAM output.
-H, --header
Print only SAM header to STDOUT. If FORMAT is sam or bam, its text version is printed, otherwise
JSON object is written.
-I, --reference-info
Output to STDOUT reference sequence names and lengths in JSON (see EXAMPLES).
-L, --regions=BEDFILE
Intersect a file with regions specified in the BED file.
-c, --count
Output to STDOUT only the number of matching records, -hHI options are ignored.
-v, --valid
Output only valid reads.
-S, --sam-input
Specify that the input is SAM file (default is BAM for all operations).
-p, --show-progress
Show progressbar in STDERR. Works only for BAM files, and with no regions specified, i.e. only
when reading full file.
-l, --compression-level=COMPRESSION_LEVEL
Set compression level for BAM output, a number from 0 to 9.
-o, --output-filename=FILENAME
Specify output filename (by default everything is written to STDOUT).
-t, --nthreads=NTHREADS
Number of threads to use.
See Also
For more information on the original samtools VIEW behaviour, check out the samtools documentation
http://samtools.sourceforge.net/samtools.shtml.
June 2016 SAMBAMBA-VIEW(1)
Synopsis
sambambaviewOPTIONS <input.bam | input.sam> [region1 [...]]
