--help Display summary of command-line options.
--version
Print the version string.
--file1filename[filenames...]
Read FASTQ reads from one or more files, either uncompressed, bzip2 compressed, or gzip
compressed. This contains either the single-end (SE) reads or, if paired-end, the mate 1 reads. If
running in paired-end mode, both --file1 and --file2 must be set. See the primary documentation
for a list of supported formats.
--file2filename[filenames...]
Read one or more FASTQ files containing mate 2 reads for a paired-end run. If specified, --file1
must also be set.
--identify-adapters
Attempt to build a consensus adapter sequence from fully overlapping pairs of paired-end reads.
The minimum overlap is controlled by --minalignmentlength. The result will be compared with the
values set using --adapter1 and --adapter2. No trimming is performed in this mode. Default is off.
--threadsn
Maximum number of threads. Defaults to 1.
FASTQoptions--qualitybasebase
The Phred quality scores encoding used in input reads - either '64' for Phred+64 (Illumina 1.3+
and 1.5+) or '33' for Phred+33 (Illumina 1.8+). In addition, the value 'solexa' may be used to
specify reads with Solexa encoded scores. Default is 33.
--qualitybase-outputbase
The base of the quality score for reads written by AdapterRemoval - either '64' for Phred+64
(i.e., Illumina 1.3+ and 1.5+) or '33' for Phred+33 (Illumina 1.8+). In addition, the value
'solexa' may be used to specify reads with Solexa encoded scores. However, note that quality
scores are represented using Phred scores internally, and conversion to and from Solexa scores
therefore result in a loss of information. The default corresponds to the value given for
--qualitybase.
--qualitymaxbase
Specifies the maximum Phred score expected in input files, and used when writing output files.
Possible values are 0 to 93 for Phred+33 encoded files, and 0 to 62 for Phred+64 encoded files.
Defaults to 41.
--mate-separatorseparator
Character separating the mate number (1 or 2) from the read name in FASTQ records. Defaults to
'/'.
--interleaved
Enables --interleaved-input and --interleaved-output.
--interleaved-input
If set, input is expected to be a interleaved FASTQ files specified using --file1, in which pairs
of reads are written one after the other (e.g. read1/1, read1/2, read2/1, read2/2, etc.).
--interleaved-ouput
Write paired-end reads to a single file, interleaving mate 1 and mate 2 reads. By default, this
file is named basename.paired.truncated, but this may be changed using the --output1 option.
--combined-output
Write all reads into the files specified by --output1 and --output2. The sequences of reads
discarded due to quality filters or read merging are replaced with a single 'N' with Phred score
0. This option can be combined with --interleaved-output to write PE reads to a single output file
specified with --output1.
Outputfileoptions--basenamefilename
Prefix used for the naming output files, unless these names have been overridden using the
corresponding command-line option (see below).
--settingsfile
Output file containing information on the parameters used in the run as well as overall statistics
on the reads after trimming. Default filename is 'basename.settings'.
--output1file
Output file containing trimmed mate1 reads. Default filename is 'basename.pair1.truncated' for
paired-end reads, 'basename.truncated' for single-end reads, and 'basename.paired.truncated' for
interleaved paired-end reads.
--output2file
Output file containing trimmed mate 2 reads when --interleaved-output is not enabled. Default
filename is 'basename.pair2.truncated' in paired-end mode.
--singletonfile
Output file to which containing paired reads for which the mate has been discarded. Default
filename is 'basename.singleton.truncated'.
--outputcollapsedfile
If --collapsed is set, contains overlapping mate-pairs which have been merged into a single read
(PE mode) or reads for which the adapter was identified by a minimum overlap, indicating that the
entire template molecule is present. This does not include which have subsequently been trimmed
due to low-quality or ambiguous nucleotides. Default filename is 'basename.collapsed'
--outputcollapsedtruncatedfile
Collapsed reads (see --outputcollapsed) which were trimmed due the presence of low-quality or
ambiguous nucleotides. Default filename is 'basename.collapsed.truncated'.
--discardedfile
Contains reads discarded due to the --minlength, --maxlength or --maxns options. Default filename
is 'basename.discarded'.
Outputcompressionoptions--gzip If set, all FASTQ files written by AdapterRemoval will be gzip compressed using the compression
level specified using --gzip-level. The extension ".gz" is added to files for which no filename
was given on the command-line. Defaults to off.
--gzip-levellevel
Determines the compression level used when gzip'ing FASTQ files. Must be a value in the range 0 to
9, with 0 disabling compression and 9 being the best compression. Defaults to 6.
--bzip2
If set, all FASTQ files written by AdapterRemoval will be bzip2 compressed using the compression
level specified using --bzip2-level. The extension ".bz2" is added to files for which no filename
was given on the command-line. Defaults to off.
--bzip2-levellevel
Determines the compression level used when bzip2'ing FASTQ files. Must be a value in the range 1
to 9, with 9 being the best compression. Defaults to 9.
FASTQtrimmingoptions--adapter1adapter
Adapter sequence expected to be found in mate 1 reads, specified in read direction. For a detailed
description of how to provide the appropriate adapter sequences, see the "Adapters" section of the
online documentation. Default is AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG.
--adapter2adapter
Adapter sequence expected to be found in mate 2 reads, specified in read direction. For a detailed
description of how to provide the appropriate adapter sequences, see the "Adapters" section of the
online documentation. Default is AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT.
--adapter-listfilename
Read one or more adapter sequences from a table. The first two columns (separated by whitespace)
of each line in the file are expected to correspond to values passed to --adapter1 and --adapter2.
In single-end mode, only column one is required. Lines starting with '#' are ignored. When
multiple rows are found in the table, AdapterRemoval will try each adapter (pair), and select the
best aligning adapters for each FASTQ read processed.
--minadapteroverlaplength
In single-end mode, reads are only trimmed if the overlap between read and the adapter is at least
X bases long, not counting ambiguous nucleotides (N); this is independent of the
--minalignmentlength when using --collapse, allowing a conservative selection of putative complete
inserts in single-end mode, while ensuring that all possible adapter contamination is trimmed. The
default is 0.
--mmmismatchrate
The allowed fraction of mismatches allowed in the aligned region. If the value is less than 1,
then the value is used directly. If `--mismatchrate is greater than 1, the rate is set to 1 /
--mismatchrate. The default setting is 3 when trimming adapters, corresponding to a maximum
mismatch rate of 1/3, and 10 when using --identify-adapters.
--shiftn
To allow for missing bases in the 5' end of the read, the program can let the alignment slip
--shift bases in the 5' end. This corresponds to starting the alignment maximum --shift
nucleotides into read2 (for paired-end) or the adapter (for single-end). The default is 2.
--trim5pn[n]
Trim the 5' of reads by a fixed amount after removing adapters, but before carrying out quality
based trimming. Specify one value to trim mate 1 and mate 2 reads the same amount, or two values
separated by a space to trim each mate different amounts. Off by default.
--trim3pn[n]
Trim the 3' of reads by a fixed amount. See --trim5p.
--trimns
Trim consecutive Ns from the 5' and 3' termini. If quality trimming is also enabled
(--trimqualities), then stretches of mixed low-quality bases and/or Ns are trimmed.
--maxnsn
Discard reads containing more than --max ambiguous bases ('N') after trimming. Default is 1000.
--trimqualities
Trim consecutive stretches of low quality bases (threshold set by --minquality) from the 5' and 3'
termini. If trimming of Ns is also enabled (--trimns), then stretches of mixed low-quality bases
and Ns are trimmed.
--trimwindowswindow_size
Trim low quality bases using a sliding window based approach inspired by sickle with the given
window size. See the "Window based quality trimming" section of the manual page for a description
of this algorithm.
--minqualityminimum
Set the threshold for trimming low quality bases using --trimqualities and --trimwindows. Default
is 2.
--preserve5p
If set, bases at the 5p will not be trimmed by --trimns, --trimqualities, and --trimwindows.
Collapsed reads will not be quality trimmed when this option is enabled.
--minlengthlength
Reads shorter than this length are discarded following trimming. Defaults to 15.
--maxlengthlength
Reads longer than this length are discarded following trimming. Defaults to 4294967295.
FASTQmergingoptions--collapse
In paired-end mode, merge overlapping mates into a single and recalculate the quality scores. In
single-end mode, attempt to identify templates for which the entire sequence is available. In both
cases, complete "collapsed" reads are written with a 'M_' name prefix, and "collapsed" reads which
are trimmed due to quality settings are written with a 'MT_' name prefix. The overlap needs to be
at least --minalignmentlength nucleotides, with a maximum number of mismatches determined by --mm.
--minalignmentlengthlength
The minimum overlap between mate 1 and mate 2 before the reads are collapsed into one, when
collapsing paired-end reads, or when attempting to identify complete template sequences in
single-end mode. Default is 11.
--seedseed
When collaping reads at positions where the two reads differ, and the quality of the bases are
identical, AdapterRemoval will select a random base. This option specifies the seed used for the
random number generator used by AdapterRemoval. This value is also written to the settings file.
Note that setting the seed is not reliable in multithreaded mode, since the order of operations is
non-deterministic.
--collapse-deterministic
Enable deterministic mode; currently only affects --collapse, different overlapping bases with
equal quality are set to N quality 0, instead of being randomly sampled. Setting this option also
sets --collapse.
--collapse-conservatively
Alternative merging algorithm inspired by FASTQ-join: For matching overlapping bases, the highest
quality score is used. For mismatching overlapping bases, the highest quality base is used and the
quality is set to the absolute difference in Phred-score between the two bases. For mismatching
bases with identical quality scores, the base is set to 'N' and the quality score to 0
(Phred-encoded). Setting this option also sets --collapse.
FASTQdemultiplexingoptions--barcode-listfilename
Perform demultiplxing using table of one or two fixed-length barcodes for SE or PE reads. The
table is expected to contain 2 or 3 columns, the first of which represent the name of a given
sample, and the second and third of which represent the mate 1 and (optionally) the mate 2 barcode
sequence. For a detailed description, see the "Demultiplexing" section of the online
documentation.
--barcode-mmnMaximumnumberofmismatchesallowedwhencountingmismatchesinboththemate1andthemate2barcodeforpairedreads.--barcode-mm-r1n
Maximum number of mismatches allowed for the mate 1 barcode; if not set, this value is equal to
the --barcode-mm value; cannot be higher than the --barcode-mm value.
--barcode-mm-r2n
Maximum number of mismatches allowed for the mate 2 barcode; if not set, this value is equal to
the --barcode-mm value; cannot be higher than the --barcode-mm value.
--demultiplex-only
Only carry out demultiplexing using the list of barcodes supplied with --barcode-list. No other
processing is done.
Install Now
