Blast-Radius Aware AI Code Review for Business-Critical Systems
LiveReview LiveReview Explore LiveReview

AdapterRemoval - Fast short-read adapter trimming and processing

Author

       Mikkel Schubert; Stinus Lindgreen

Description

AdapterRemoval  removes  residual  adapter sequences from single-end (SE) or paired-end (PE) FASTQ reads,
       optionally trimming Ns and low qualities bases and/or collapsing overlapping paired-end  mates  into  one
       read.  Low  quality  reads  are  filtered  based  on  the  resulting  length  and the number of ambigious
       nucleotides ('N') present  following  trimming.  These  operations  may  be  combined  with  simultaneous
       demultiplexing  using  5'  barcode  sequences. Alternatively, AdapterRemoval may attempt to reconstruct a
       consensus adapter sequences from paired-end data, in order to allow the  identification  of  the  adapter
       sequences originally used.

       If you use this program, please cite the paper:
          Schubert,  Lindgreen,  and  Orlando (2016). AdapterRemoval v2: rapid adapter trimming, identification,
          and read merging. BMC Research Notes, 12;9(1):88

          http://bmcresnotes.biomedcentral.com/articles/10.1186/s13104-016-1900-2

       For detailed documentation, please see
          http://adapterremoval.readthedocs.io/

Exit Status

       AdapterRemoval  exists with status 0 if the program ran succesfully, and with a non-zero exit code if any
       errors were encountered. Do not use the output from AdapterRemoval if the  program  returned  a  non-zero
       exit code!

License

       This  program  is  free  software;  you  can  redistribute it and/or modify it under the terms of the GNU
       General Public License as published by the Free Software Foundation; either version 3 of the License,  or
       at your option any later version.

       This  program  is  distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even
       the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU General  Public
       License for more details.

       You  should  have received a copy of the GNU General Public License along with this program.  If not, see
       <http://www.gnu.org/licenses/>.

Name

       AdapterRemoval - Fast short-read adapter trimming and processing

Options

--help Display summary of command-line options.

       --version
              Print the version string.

       --file1filename[filenames...]
              Read FASTQ reads  from  one  or  more  files,  either  uncompressed,  bzip2  compressed,  or  gzip
              compressed. This contains either the single-end (SE) reads or, if paired-end, the mate 1 reads. If
              running  in  paired-end  mode, both --file1 and --file2 must be set. See the primary documentation
              for a list of supported formats.

       --file2filename[filenames...]
              Read one or more FASTQ files containing mate 2 reads for a paired-end run. If  specified,  --file1
              must also be set.

       --identify-adapters
              Attempt  to  build  a consensus adapter sequence from fully overlapping pairs of paired-end reads.
              The minimum overlap is controlled by --minalignmentlength. The result will be  compared  with  the
              values set using --adapter1 and --adapter2. No trimming is performed in this mode. Default is off.

       --threadsn
              Maximum number of threads. Defaults to 1.

   FASTQoptions--qualitybasebase
              The  Phred  quality  scores encoding used in input reads - either '64' for Phred+64 (Illumina 1.3+
              and 1.5+) or '33' for Phred+33 (Illumina 1.8+). In addition, the value 'solexa'  may  be  used  to
              specify reads with Solexa encoded scores. Default is 33.

       --qualitybase-outputbase
              The  base  of  the  quality  score  for reads written by AdapterRemoval - either '64' for Phred+64
              (i.e., Illumina 1.3+ and 1.5+) or '33' for  Phred+33  (Illumina  1.8+).  In  addition,  the  value
              'solexa'  may  be  used  to  specify  reads with Solexa encoded scores. However, note that quality
              scores are represented using Phred scores internally, and conversion to  and  from  Solexa  scores
              therefore  result  in  a  loss  of  information.  The  default  corresponds to the value given for
              --qualitybase.

       --qualitymaxbase
              Specifies the maximum Phred score expected in input files, and used  when  writing  output  files.
              Possible  values  are  0 to 93 for Phred+33 encoded files, and 0 to 62 for Phred+64 encoded files.
              Defaults to 41.

       --mate-separatorseparator
              Character separating the mate number (1 or 2) from the read name in  FASTQ  records.  Defaults  to
              '/'.

       --interleaved
              Enables --interleaved-input and --interleaved-output.

       --interleaved-input
              If  set, input is expected to be a interleaved FASTQ files specified using --file1, in which pairs
              of reads are written one after the other (e.g. read1/1, read1/2, read2/1, read2/2, etc.).

       --interleaved-ouput
              Write paired-end reads to a single file, interleaving mate 1 and mate 2 reads.  By  default,  this
              file is named basename.paired.truncated, but this may be changed using the --output1 option.

       --combined-output
              Write  all  reads  into  the  files  specified  by --output1 and --output2. The sequences of reads
              discarded due to quality filters or read merging are replaced with a single 'N' with  Phred  score
              0. This option can be combined with --interleaved-output to write PE reads to a single output file
              specified with --output1.

   Outputfileoptions--basenamefilename
              Prefix  used  for  the  naming  output  files,  unless  these names have been overridden using the
              corresponding command-line option (see below).

       --settingsfile
              Output file containing information on the parameters used in the run as well as overall statistics
              on the reads after trimming. Default filename is 'basename.settings'.

       --output1file
              Output file containing trimmed mate1 reads. Default  filename  is  'basename.pair1.truncated'  for
              paired-end  reads,  'basename.truncated' for single-end reads, and 'basename.paired.truncated' for
              interleaved paired-end reads.

       --output2file
              Output file containing trimmed mate 2 reads when  --interleaved-output  is  not  enabled.  Default
              filename is 'basename.pair2.truncated' in paired-end mode.

       --singletonfile
              Output  file  to  which  containing  paired  reads  for which the mate has been discarded. Default
              filename is 'basename.singleton.truncated'.

       --outputcollapsedfile
              If --collapsed is set, contains overlapping mate-pairs which have been merged into a  single  read
              (PE  mode) or reads for which the adapter was identified by a minimum overlap, indicating that the
              entire template molecule is present. This does not include which have  subsequently  been  trimmed
              due to low-quality or ambiguous nucleotides. Default filename is 'basename.collapsed'

       --outputcollapsedtruncatedfile
              Collapsed  reads  (see  --outputcollapsed)  which  were trimmed due the presence of low-quality or
              ambiguous nucleotides. Default filename is 'basename.collapsed.truncated'.

       --discardedfile
              Contains reads discarded due to the --minlength, --maxlength or --maxns options. Default  filename
              is 'basename.discarded'.

   Outputcompressionoptions--gzip If  set,  all  FASTQ files written by AdapterRemoval will be gzip compressed using the compression
              level specified using --gzip-level. The extension ".gz" is added to files for  which  no  filename
              was given on the command-line. Defaults to off.

       --gzip-levellevel
              Determines the compression level used when gzip'ing FASTQ files. Must be a value in the range 0 to
              9, with 0 disabling compression and 9 being the best compression. Defaults to 6.

       --bzip2
              If  set,  all FASTQ files written by AdapterRemoval will be bzip2 compressed using the compression
              level specified using --bzip2-level. The extension ".bz2" is added to files for which no  filename
              was given on the command-line. Defaults to off.

       --bzip2-levellevel
              Determines  the  compression level used when bzip2'ing FASTQ files. Must be a value in the range 1
              to 9, with 9 being the best compression. Defaults to 9.

   FASTQtrimmingoptions--adapter1adapter
              Adapter sequence expected to be found in mate 1 reads, specified in read direction. For a detailed
              description of how to provide the appropriate adapter sequences, see the "Adapters" section of the
              online documentation. Default is AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG.

       --adapter2adapter
              Adapter sequence expected to be found in mate 2 reads, specified in read direction. For a detailed
              description of how to provide the appropriate adapter sequences, see the "Adapters" section of the
              online documentation. Default is AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT.

       --adapter-listfilename
              Read one or more adapter sequences from a table. The first two columns (separated  by  whitespace)
              of each line in the file are expected to correspond to values passed to --adapter1 and --adapter2.
              In  single-end  mode,  only  column  one  is  required.  Lines starting with '#' are ignored. When
              multiple rows are found in the table, AdapterRemoval will try each adapter (pair), and select  the
              best aligning adapters for each FASTQ read processed.

       --minadapteroverlaplength
              In single-end mode, reads are only trimmed if the overlap between read and the adapter is at least
              X   bases   long,   not   counting   ambiguous   nucleotides  (N);  this  is  independent  of  the
              --minalignmentlength when using --collapse, allowing a conservative selection of putative complete
              inserts in single-end mode, while ensuring that all possible adapter contamination is trimmed. The
              default is 0.

       --mmmismatchrate
              The allowed fraction of mismatches allowed in the aligned region. If the value  is  less  than  1,
              then  the  value  is  used  directly. If `--mismatchrate is greater than 1, the rate is set to 1 /
              --mismatchrate. The default setting is 3  when  trimming  adapters,  corresponding  to  a  maximum
              mismatch rate of 1/3, and 10 when using --identify-adapters.

       --shiftn
              To  allow  for  missing  bases  in  the 5' end of the read, the program can let the alignment slip
              --shift bases in  the  5'  end.  This  corresponds  to  starting  the  alignment  maximum  --shift
              nucleotides into read2 (for paired-end) or the adapter (for single-end). The default is 2.

       --trim5pn[n]
              Trim  the  5'  of reads by a fixed amount after removing adapters, but before carrying out quality
              based trimming. Specify one value to trim mate 1 and mate 2 reads the same amount, or  two  values
              separated by a space to trim each mate different amounts. Off by default.

       --trim3pn[n]
              Trim the 3' of reads by a fixed amount. See --trim5p.

       --trimns
              Trim   consecutive  Ns  from  the  5'  and  3'  termini.  If  quality  trimming  is  also  enabled
              (--trimqualities), then stretches of mixed low-quality bases and/or Ns are trimmed.

       --maxnsn
              Discard reads containing more than --max ambiguous bases ('N') after trimming. Default is 1000.

       --trimqualities
              Trim consecutive stretches of low quality bases (threshold set by --minquality) from the 5' and 3'
              termini. If trimming of Ns is also enabled (--trimns), then stretches of mixed  low-quality  bases
              and Ns are trimmed.

       --trimwindowswindow_size
              Trim  low  quality  bases  using a sliding window based approach inspired by sickle with the given
              window size. See the "Window based quality trimming" section of the manual page for a  description
              of this algorithm.

       --minqualityminimum
              Set  the threshold for trimming low quality bases using --trimqualities and --trimwindows. Default
              is 2.

       --preserve5p
              If set, bases at the 5p will not be  trimmed  by  --trimns,  --trimqualities,  and  --trimwindows.
              Collapsed reads will not be quality trimmed when this option is enabled.

       --minlengthlength
              Reads shorter than this length are discarded following trimming. Defaults to 15.

       --maxlengthlength
              Reads longer than this length are discarded following trimming. Defaults to 4294967295.

   FASTQmergingoptions--collapse
              In  paired-end  mode, merge overlapping mates into a single and recalculate the quality scores. In
              single-end mode, attempt to identify templates for which the entire sequence is available. In both
              cases, complete "collapsed" reads are written with a 'M_' name prefix, and "collapsed" reads which
              are trimmed due to quality settings are written with a 'MT_' name prefix. The overlap needs to  be
              at least --minalignmentlength nucleotides, with a maximum number of mismatches determined by --mm.

       --minalignmentlengthlength
              The  minimum  overlap  between  mate  1  and  mate 2 before the reads are collapsed into one, when
              collapsing paired-end reads, or  when  attempting  to  identify  complete  template  sequences  in
              single-end mode. Default is 11.

       --seedseed
              When  collaping  reads  at  positions where the two reads differ, and the quality of the bases are
              identical, AdapterRemoval will select a random base. This option specifies the seed used  for  the
              random  number  generator used by AdapterRemoval. This value is also written to the settings file.
              Note that setting the seed is not reliable in multithreaded mode, since the order of operations is
              non-deterministic.

       --collapse-deterministic
              Enable deterministic mode; currently only affects --collapse,  different  overlapping  bases  with
              equal  quality are set to N quality 0, instead of being randomly sampled. Setting this option also
              sets --collapse.

       --collapse-conservatively
              Alternative merging algorithm inspired by FASTQ-join: For matching overlapping bases, the  highest
              quality score is used. For mismatching overlapping bases, the highest quality base is used and the
              quality  is  set  to the absolute difference in Phred-score between the two bases. For mismatching
              bases with identical quality scores,  the  base  is  set  to  'N'  and  the  quality  score  to  0
              (Phred-encoded). Setting this option also sets --collapse.

   FASTQdemultiplexingoptions--barcode-listfilename
              Perform  demultiplxing  using  table  of  one or two fixed-length barcodes for SE or PE reads. The
              table is expected to contain 2 or 3 columns, the first of which represent  the  name  of  a  given
              sample, and the second and third of which represent the mate 1 and (optionally) the mate 2 barcode
              sequence.   For   a   detailed  description,  see  the  "Demultiplexing"  section  of  the  online
              documentation.

       --barcode-mmnMaximumnumberofmismatchesallowedwhencountingmismatchesinboththemate1andthemate2barcodeforpairedreads.--barcode-mm-r1n
              Maximum number of mismatches allowed for the mate 1 barcode; if not set, this value  is  equal  to
              the --barcode-mm value; cannot be higher than the --barcode-mm value.

       --barcode-mm-r2n
              Maximum  number  of  mismatches allowed for the mate 2 barcode; if not set, this value is equal to
              the --barcode-mm value; cannot be higher than the --barcode-mm value.

       --demultiplex-only
              Only carry out demultiplexing using the list of barcodes supplied with  --barcode-list.  No  other
              processing is done.

Reporting Bugs

       Please report any bugs using the AdapterRemoval issue-tracker:

       https://github.com/MikkelSchubert/adapterremoval/issues

Synopsis

AdapterRemoval [options...] --file1 <filenames> [--file2 <filenames>]

Window Based Quality Trimming

       As  of  v2.2.2,  AdapterRemoval  implements  sliding window based approach to quality based base-trimming
       inspired by sickle. If window_size is greater than or equal to 1, that number is used as the window  size
       for all reads. If window_size is a number greater than or equal to 0 and less than 1, then that number is
       multiplied  by  the length of individual reads to determine the window size. If the window length is zero
       or is greater than the current read length, then the read length is used instead.

       Reads are trimmed as follows for a given window size:

          1. The new 5' is determined by locating the first window  where  both  the  average  quality  and  the
             quality of the first base in the window is greater than --minquality.

          2. The  new  3'  is  located by sliding the first window right, until the average quality becomes less
             than or equal to --minquality. The new 3' is placed at the last  base  in  that  window  where  the
             quality is greater than or equal to --minquality.

          3. If no 5' position could be determined, the read is discarded.

See Also