logo
Free, unlimited AI code reviews that run on commit
git-lrc git-lrc GitHub Install Now We'd appreciate a star git-lrc - Free, unlimited AI code reviews that run on commit | Product Hunt git-lrc - Free, unlimited AI code reviews that run on commit | Product Hunt

perlretut - Perl regular expressions tutorial

Description

       This page provides a basic tutorial on understanding, creating and using regular expressions in Perl.  It
       serves as a complement to the reference page on regular expressions perlre.  Regular expressions are an
       integral part of the "m//", "s///", "qr//" and "split" operators and so this tutorial also overlaps with
       "Regexp Quote-Like Operators" in perlop and "split" in perlfunc.

       Perl is widely renowned for excellence in text processing, and regular expressions are one of the big
       factors behind this fame.  Perl regular expressions display an efficiency and flexibility unknown in most
       other computer languages.  Mastering even the basics of regular expressions will allow you to manipulate
       text with surprising ease.

       What is a regular expression?  At its most basic, a regular expression is a template that is used to
       determine if a string has certain characteristics.  The string is most often some text, such as a line,
       sentence, web page, or even a whole book, but it doesn't have to be.  It could be binary data, for
       example.  Biologists often use Perl to look for patterns in long DNA sequences.

       Suppose we want to determine if the text in variable, $var contains the sequence of characters
       "m u s h r o o m" (blanks added for legibility).  We can write in Perl

        $var =~ m/mushroom/

       The value of this expression will be TRUE if $var contains that sequence of characters anywhere within
       it, and FALSE otherwise.  The portion enclosed in '/' characters denotes the characteristic we are
       looking for.  We use the term pattern for it.  The process of looking to see if the pattern occurs in the
       string is called matching, and the "=~" operator along with the "m//" tell Perl to try to match the
       pattern against the string.  Note that the pattern is also a string, but a very special kind of one, as
       we will see.  Patterns are in common use these days; examples are the patterns typed into a search engine
       to find web pages and the patterns used to list files in a directory, e.g., ""ls *.txt"" or ""dir *.*"".
       In Perl, the patterns described by regular expressions are used not only to search strings, but to also
       extract desired parts of strings, and to do search and replace operations.

       Regular expressions have the undeserved reputation of being abstract and difficult to understand.  This
       really stems simply because the notation used to express them tends to be terse and dense, and not
       because of inherent complexity.  We recommend using the "/x" regular expression modifier (described
       below) along with plenty of white space to make them less dense, and easier to read.  Regular expressions
       are constructed using simple concepts like conditionals and loops and are no more difficult to understand
       than the corresponding "if" conditionals and "while" loops in the Perl language itself.

       This tutorial flattens the learning curve by discussing regular expression concepts, along with their
       notation, one at a time and with many examples.  The first part of the tutorial will progress from the
       simplest word searches to the basic regular expression concepts.  If you master the first part, you will
       have all the tools needed to solve about 98% of your needs.  The second part of the tutorial is for those
       comfortable with the basics, and hungry for more power tools.  It discusses the more advanced regular
       expression operators and introduces the latest cutting-edge innovations.

       A note: to save time, "regular expression" is often abbreviated as regexp or regex.  Regexp is a more
       natural abbreviation than regex, but is harder to pronounce.  The Perl pod documentation is evenly split
       on regexp vs regex; in Perl, there is more than one way to abbreviate it.  We'll use regexp in this
       tutorial.

       New in v5.22, "use re 'strict'" applies stricter rules than otherwise when compiling regular expression
       patterns.  It can find things that, while legal, may not be what you intended.

Name

       perlretut - Perl regular expressions tutorial

Part 1: The Basics

Simplewordmatching
       The simplest regexp is simply a word, or more generally, a string of characters.  A regexp consisting of
       just a word matches any string that contains that word:

           "Hello World" =~ /World/;  # matches

       What is this Perl statement all about? "Hello World" is a simple double-quoted string.  "World" is the
       regular expression and the "//" enclosing "/World/" tells Perl to search a string for a match.  The
       operator "=~" associates the string with the regexp match and produces a true value if the regexp
       matched, or false if the regexp did not match.  In our case, "World" matches the second word in "Hello
       World", so the expression is true.  Expressions like this are useful in conditionals:

           if ("Hello World" =~ /World/) {
               print "It matches\n";
           }
           else {
               print "It doesn't match\n";
           }

       There are useful variations on this theme.  The sense of the match can be reversed by using the "!~"
       operator:

           if ("Hello World" !~ /World/) {
               print "It doesn't match\n";
           }
           else {
               print "It matches\n";
           }

       The literal string in the regexp can be replaced by a variable:

           my $greeting = "World";
           if ("Hello World" =~ /$greeting/) {
               print "It matches\n";
           }
           else {
               print "It doesn't match\n";
           }

       If you're matching against the special default variable $_, the "$_ =~" part can be omitted:

           $_ = "Hello World";
           if (/World/) {
               print "It matches\n";
           }
           else {
               print "It doesn't match\n";
           }

       And finally, the "//" default delimiters for a match can be changed to arbitrary delimiters by putting an
       'm' out front:

           "Hello World" =~ m!World!;   # matches, delimited by '!'
           "Hello World" =~ m{World};   # matches, note the paired '{}'
           "/usr/bin/perl" =~ m"/perl"; # matches after '/usr/bin',
                                        # '/' becomes an ordinary char

       "/World/", "m!World!", and "m{World}" all represent the same thing.  When, e.g., the quote ('"') is used
       as a delimiter, the forward slash '/' becomes an ordinary character and can be used in this regexp
       without trouble.

       Let's consider how different regexps would match "Hello World":

           "Hello World" =~ /world/;  # doesn't match
           "Hello World" =~ /o W/;    # matches
           "Hello World" =~ /oW/;     # doesn't match
           "Hello World" =~ /World /; # doesn't match

       The first regexp "world" doesn't match because regexps are by default case-sensitive.  The second regexp
       matches because the substring 'o W' occurs in the string "Hello World".  The space character ' ' is
       treated like any other character in a regexp and is needed to match in this case.  The lack of a space
       character is the reason the third regexp 'oW' doesn't match.  The fourth regexp ""World "" doesn't match
       because there is a space at the end of the regexp, but not at the end of the string.  The lesson here is
       that regexps must match a part of the string exactly in order for the statement to be true.

       If a regexp matches in more than one place in the string, Perl will always match at the earliest possible
       point in the string:

           "Hello World" =~ /o/;       # matches 'o' in 'Hello'
           "That hat is red" =~ /hat/; # matches 'hat' in 'That'

       With respect to character matching, there are a few more points you need to know about.   First of all,
       not all characters can be used "as-is" in a match.  Some characters, called metacharacters, are generally
       reserved for use in regexp notation.  The metacharacters are

           {}[]()^$.|*+?-#\

       This list is not as definitive as it may appear (or be claimed to be in other documentation).  For
       example, "#" is a metacharacter only when the "/x" pattern modifier (described below) is used, and both
       "}" and "]" are metacharacters only when paired with opening "{" or "[" respectively; other gotchas
       apply.

       The significance of each of these will be explained in the rest of the tutorial, but for now, it is
       important only to know that a metacharacter can be matched as-is by putting a backslash before it:

           "2+2=4" =~ /2+2/;    # doesn't match, + is a metacharacter
           "2+2=4" =~ /2\+2/;   # matches, \+ is treated like an ordinary +
           "The interval is [0,1)." =~ /[0,1)./     # is a syntax error!
           "The interval is [0,1)." =~ /\[0,1\)\./  # matches
           "#!/usr/bin/perl" =~ /#!\/usr\/bin\/perl/;  # matches

       In the last regexp, the forward slash '/' is also backslashed, because it is used to delimit the regexp.
       This can lead to LTS (leaning toothpick syndrome), however, and it is often more readable to change
       delimiters.

           "#!/usr/bin/perl" =~ m!#\!/usr/bin/perl!;  # easier to read

       The backslash character '\' is a metacharacter itself and needs to be backslashed:

           'C:\WIN32' =~ /C:\\WIN/;   # matches

       In situations where it doesn't make sense for a particular metacharacter to mean what it normally does,
       it automatically loses its metacharacter-ness and becomes an ordinary character that is to be matched
       literally.  For example, the '}' is a metacharacter only when it is the mate of a '{' metacharacter.
       Otherwise it is treated as a literal RIGHT CURLY BRACKET.  This may lead to unexpected results.  "use re
       'strict'" can catch some of these.

       In addition to the metacharacters, there are some ASCII characters which don't have printable character
       equivalents and are instead represented by escapesequences.  Common examples are "\t" for a tab, "\n"
       for a newline, "\r" for a carriage return and "\a" for a bell (or alert).  If your string is better
       thought of as a sequence of arbitrary bytes, the octal escape sequence, e.g., "\033", or hexadecimal
       escape sequence, e.g., "\x1B" may be a more natural representation for your bytes.  Here are some
       examples of escapes:

           "1000\t2000" =~ m(0\t2)   # matches
           "1000\n2000" =~ /0\n20/   # matches
           "1000\t2000" =~ /\000\t2/ # doesn't match, "0" ne "\000"
           "cat"   =~ /\o{143}\x61\x74/ # matches in ASCII, but a weird way
                                        # to spell cat

       If you've been around Perl a while, all this talk of escape sequences may seem familiar.  Similar escape
       sequences are used in double-quoted strings and in fact the regexps in Perl are mostly treated as double-
       quoted strings.  This means that variables can be used in regexps as well.  Just like double-quoted
       strings, the values of the variables in the regexp will be substituted in before the regexp is evaluated
       for matching purposes.  So we have:

           $foo = 'house';
           'housecat' =~ /$foo/;      # matches
           'cathouse' =~ /cat$foo/;   # matches
           'housecat' =~ /${foo}cat/; # matches

       So far, so good.  With the knowledge above you can already perform searches with just about any literal
       string regexp you can dream up.  Here is a verysimple emulation of the Unix grep program:

           % cat > simple_grep
           #!/usr/bin/perl
           $regexp = shift;
           while (<>) {
               print if /$regexp/;
           }
           ^D

           % chmod +x simple_grep

           % simple_grep abba /usr/dict/words
           Babbage
           cabbage
           cabbages
           sabbath
           Sabbathize
           Sabbathizes
           sabbatical
           scabbard
           scabbards

       This program is easy to understand.  "#!/usr/bin/perl" is the standard way to invoke a perl program from
       the shell.  "$regexp = shift;" saves the first command line argument as the regexp to be used, leaving
       the rest of the command line arguments to be treated as files.  "while (<>)" loops over all the lines in
       all the files.  For each line, "print if /$regexp/;" prints the line if the regexp matches the line.  In
       this line, both "print" and "/$regexp/" use the default variable $_ implicitly.

       With all of the regexps above, if the regexp matched anywhere in the string, it was considered a match.
       Sometimes, however, we'd like to specify where in the string the regexp should try to match.  To do this,
       we would use the anchor metacharacters '^' and '$'.  The anchor '^' means match at the beginning of the
       string and the anchor '$' means match at the end of the string, or before a newline at the end of the
       string.  Here is how they are used:

           "housekeeper" =~ /keeper/;    # matches
           "housekeeper" =~ /^keeper/;   # doesn't match
           "housekeeper" =~ /keeper$/;   # matches
           "housekeeper\n" =~ /keeper$/; # matches

       The second regexp doesn't match because '^' constrains "keeper" to match only at the beginning of the
       string, but "housekeeper" has keeper starting in the middle.  The third regexp does match, since the '$'
       constrains "keeper" to match only at the end of the string.

       When both '^' and '$' are used at the same time, the regexp has to match both the beginning and the end
       of the string, i.e., the regexp matches the whole string.  Consider

           "keeper" =~ /^keep$/;      # doesn't match
           "keeper" =~ /^keeper$/;    # matches
           ""       =~ /^$/;          # ^$ matches an empty string

       The first regexp doesn't match because the string has more to it than "keep".  Since the second regexp is
       exactly the string, it matches.  Using both '^' and '$' in a regexp forces the complete string to match,
       so it gives you complete control over which strings match and which don't.  Suppose you are looking for a
       fellow named bert, off in a string by himself:

           "dogbert" =~ /bert/;   # matches, but not what you want

           "dilbert" =~ /^bert/;  # doesn't match, but ..
           "bertram" =~ /^bert/;  # matches, so still not good enough

           "bertram" =~ /^bert$/; # doesn't match, good
           "dilbert" =~ /^bert$/; # doesn't match, good
           "bert"    =~ /^bert$/; # matches, perfect

       Of course, in the case of a literal string, one could just as easily use the string comparison
       "$string eq 'bert'" and it would be more efficient.   The  "^...$" regexp really becomes useful when we
       add in the more powerful regexp tools below.

   Usingcharacterclasses
       Although one can already do quite a lot with the literal string regexps above, we've only scratched the
       surface of regular expression technology.  In this and subsequent sections we will introduce regexp
       concepts (and associated metacharacter notations) that will allow a regexp to represent not just a single
       character sequence, but a wholeclass of them.

       One such concept is that of a characterclass.  A character class allows a set of possible characters,
       rather than just a single character, to match at a particular point in a regexp.  You can define your own
       custom character classes.  These are denoted by brackets "[...]", with the set of characters to be
       possibly matched inside.  Here are some examples:

           /cat/;       # matches 'cat'
           /[bcr]at/;   # matches 'bat, 'cat', or 'rat'
           /item[0123456789]/;  # matches 'item0' or ... or 'item9'
           "abc" =~ /[cab]/;    # matches 'a'

       In the last statement, even though 'c' is the first character in the class, 'a' matches because the first
       character position in the string is the earliest point at which the regexp can match.

           /[yY][eE][sS]/;      # match 'yes' in a case-insensitive way
                                # 'yes', 'Yes', 'YES', etc.

       This regexp displays a common task: perform a case-insensitive match.  Perl provides a way of avoiding
       all those brackets by simply appending an 'i' to the end of the match.  Then "/[yY][eE][sS]/;" can be
       rewritten as "/yes/i;".  The 'i' stands for case-insensitive and is an example of a modifier of the
       matching operation.  We will meet other modifiers later in the tutorial.

       We saw in the section above that there were ordinary characters, which represented themselves, and
       special characters, which needed a backslash '\' to represent themselves.  The same is true in a
       character class, but the sets of ordinary and special characters inside a character class are different
       than those outside a character class.  The special characters for a character class are "-]\^$" (and the
       pattern delimiter, whatever it is).  ']' is special because it denotes the end of a character class.  '$'
       is special because it denotes a scalar variable.  '\' is special because it is used in escape sequences,
       just like above.  Here is how the special characters "]$\" are handled:

          /[\]c]def/; # matches ']def' or 'cdef'
          $x = 'bcr';
          /[$x]at/;   # matches 'bat', 'cat', or 'rat'
          /[\$x]at/;  # matches '$at' or 'xat'
          /[\\$x]at/; # matches '\at', 'bat, 'cat', or 'rat'

       The last two are a little tricky.  In "[\$x]", the backslash protects the dollar sign, so the character
       class has two members '$' and 'x'.  In "[\\$x]", the backslash is protected, so $x is treated as a
       variable and substituted in double quote fashion.

       The special character '-' acts as a range operator within character classes, so that a contiguous set of
       characters can be written as a range.  With ranges, the unwieldy "[0123456789]" and "[abc...xyz]" become
       the svelte "[0-9]" and "[a-z]".  Some examples are

           /item[0-9]/;  # matches 'item0' or ... or 'item9'
           /[0-9bx-z]aa/;  # matches '0aa', ..., '9aa',
                           # 'baa', 'xaa', 'yaa', or 'zaa'
           /[0-9a-fA-F]/;  # matches a hexadecimal digit
           /[0-9a-zA-Z_]/; # matches a "word" character,
                           # like those in a Perl variable name

       If '-' is the first or last character in a character class, it is treated as an ordinary character;
       "[-ab]", "[ab-]" and "[a\-b]" are all equivalent.

       The special character '^' in the first position of a character class denotes a negatedcharacterclass,
       which matches any character but those in the brackets.  Both "[...]" and "[^...]" must match a character,
       or the match fails.  Then

           /[^a]at/;  # doesn't match 'aat' or 'at', but matches
                      # all other 'bat', 'cat, '0at', '%at', etc.
           /[^0-9]/;  # matches a non-numeric character
           /[a^]at/;  # matches 'aat' or '^at'; here '^' is ordinary

       Now, even "[0-9]" can be a bother to write multiple times, so in the interest of saving keystrokes and
       making regexps more readable, Perl has several abbreviations for common character classes, as shown
       below.  Since the introduction of Unicode, unless the "/a" modifier is in effect, these character classes
       match more than just a few characters in the ASCII range.

       •   "\d" matches a digit, not just "[0-9]" but also digits from non-roman scripts

       •   "\s" matches a whitespace character, the set "[\ \t\r\n\f]" and others

       •   "\w"  matches  a  word  character  (alphanumeric or '_'), not just "[0-9a-zA-Z_]" but also digits and
           characters from non-roman scripts

       •   "\D" is a negated "\d"; it represents any other character than a digit, or "[^\d]"

       •   "\S" is a negated "\s"; it represents any non-whitespace character "[^\s]"

       •   "\W" is a negated "\w"; it represents any non-word character "[^\w]"

       •   The period '.' matches any character but "\n" (unless the modifier "/s" is in  effect,  as  explained
           below).

       •   "\N",  like  the  period,  matches  any  character but "\n", but it does so regardless of whether the
           modifier "/s" is in effect.

       The "/a" modifier, available starting in Perl 5.14,  is used to restrict the matches of "\d",  "\s",  and
       "\w"  to  just those in the ASCII range.  It is useful to keep your program from being needlessly exposed
       to full Unicode (and its accompanying security considerations) when all you want is to  process  English-
       like  text.   (The  "a"  may  be  doubled,  "/aa",  to  provide  even more restrictions, preventing case-
       insensitive matching of ASCII  with  non-ASCII  characters;  otherwise  a  Unicode  "Kelvin  Sign"  would
       caselessly match a "k" or "K".)

       The  "\d\s\w\D\S\W"  abbreviations  can  be  used both inside and outside of bracketed character classes.
       Here are some in use:

           /\d\d:\d\d:\d\d/; # matches a hh:mm:ss time format
           /[\d\s]/;         # matches any digit or whitespace character
           /\w\W\w/;         # matches a word char, followed by a
                             # non-word char, followed by a word char
           /..rt/;           # matches any two chars, followed by 'rt'
           /end\./;          # matches 'end.'
           /end[.]/;         # same thing, matches 'end.'

       Because a period is a metacharacter, it needs to be escaped to match as an ordinary period. Because,  for
       example, "\d" and "\w" are sets of characters, it is incorrect to think of "[^\d\w]" as "[\D\W]"; in fact
       "[^\d\w]" is the same as "[^\w]", which is the same as "[\W]". Think De Morgan's laws.

       In  actuality,  the period and "\d\s\w\D\S\W" abbreviations are themselves types of character classes, so
       the ones surrounded by brackets are  just  one  type  of  character  class.   When  we  need  to  make  a
       distinction, we refer to them as "bracketed character classes."

       An  anchor  useful  in  basic  regexps  is  the wordanchor "\b".  This matches a boundary between a word
       character and a non-word character "\w\W" or "\W\w":

           $x = "Housecat catenates house and cat";
           $x =~ /cat/;    # matches cat in 'housecat'
           $x =~ /\bcat/;  # matches cat in 'catenates'
           $x =~ /cat\b/;  # matches cat in 'housecat'
           $x =~ /\bcat\b/;  # matches 'cat' at end of string

       Note in the last example, the end of the string is considered a word boundary.

       For natural language processing (so that, for example, apostrophes are included in  words),  use  instead
       "\b{wb}"

           "don't" =~ / .+? \b{wb} /x;  # matches the whole string

       You  might wonder why '.' matches everything but "\n" - why not every character? The reason is that often
       one is matching against lines and would like to ignore the newline characters.  For instance,  while  the
       string "\n" represents one line, we would like to think of it as empty.  Then

           ""   =~ /^$/;    # matches
           "\n" =~ /^$/;    # matches, $ anchors before "\n"

           ""   =~ /./;      # doesn't match; it needs a char
           ""   =~ /^.$/;    # doesn't match; it needs a char
           "\n" =~ /^.$/;    # doesn't match; it needs a char other than "\n"
           "a"  =~ /^.$/;    # matches
           "a\n"  =~ /^.$/;  # matches, $ anchors before "\n"

       This  behavior  is  convenient,  because  we  usually  want  to  ignore  newlines when we count and match
       characters in a line.  Sometimes, however, we want to keep track of newlines.  We might even want '^' and
       '$' to anchor at the beginning and end of lines within the string, rather than just the beginning and end
       of the string.  Perl allows us to choose between ignoring and paying attention to newlines by  using  the
       "/s" and "/m" modifiers.  "/s" and "/m" stand for single line and multi-line and they determine whether a
       string  is  to  be  treated as one continuous string, or as a set of lines.  The two modifiers affect two
       aspects of how the regexp is interpreted: 1) how the '.' character class is defined,  and  2)  where  the
       anchors '^' and '$' are able to match.  Here are the four possible combinations:

       •   no  modifiers:  Default  behavior.   '.'  matches any character except "\n".  '^' matches only at the
           beginning of the string and '$' matches only at the end or before a newline at the end.

       •   s modifier ("/s"): Treat string as a single long line.  '.' matches any character,  even  "\n".   '^'
           matches  only  at  the beginning of the string and '$' matches only at the end or before a newline at
           the end.

       •   m modifier ("/m"): Treat string as a set of multiple lines.  '.' matches any character  except  "\n".
           '^' and '$' are able to match at the start or end of any line within the string.

       •   both  s  and m modifiers ("/sm"): Treat string as a single long line, but detect multiple lines.  '.'
           matches any character, even "\n".  '^' and '$', however, are able to match at the start or end of any
           line within the string.

       Here are examples of "/s" and "/m" in action:

           $x = "There once was a girl\nWho programmed in Perl\n";

           $x =~ /^Who/;   # doesn't match, "Who" not at start of string
           $x =~ /^Who/s;  # doesn't match, "Who" not at start of string
           $x =~ /^Who/m;  # matches, "Who" at start of second line
           $x =~ /^Who/sm; # matches, "Who" at start of second line

           $x =~ /girl.Who/;   # doesn't match, "." doesn't match "\n"
           $x =~ /girl.Who/s;  # matches, "." matches "\n"
           $x =~ /girl.Who/m;  # doesn't match, "." doesn't match "\n"
           $x =~ /girl.Who/sm; # matches, "." matches "\n"

       Most of the time, the default behavior is what is wanted, but "/s" and "/m" are occasionally very useful.
       If "/m" is being used, the start of the string can still be matched with "\A" and the end of  the  string
       can  still  be matched with the anchors "\Z" (matches both the end and the newline before, like '$'), and
       "\z" (matches only the end):

           $x =~ /^Who/m;   # matches, "Who" at start of second line
           $x =~ /\AWho/m;  # doesn't match, "Who" is not at start of string

           $x =~ /girl$/m;  # matches, "girl" at end of first line
           $x =~ /girl\Z/m; # doesn't match, "girl" is not at end of string

           $x =~ /Perl\Z/m; # matches, "Perl" is at newline before end
           $x =~ /Perl\z/m; # doesn't match, "Perl" is not at end of string

       We now know how to create choices among classes of characters in a  regexp.   What  about  choices  among
       words or character strings? Such choices are described in the next section.

   Matchingthisorthat
       Sometimes  we  would  like  our regexp to be able to match different possible words or character strings.
       This is accomplished by using the alternation metacharacter '|'.  To match "dog" or "cat",  we  form  the
       regexp  "dog|cat".   As  before,  Perl will try to match the regexp at the earliest possible point in the
       string.  At each character position, Perl will first try to match the first alternative, "dog".  If "dog"
       doesn't match, Perl will then try the next alternative, "cat".  If "cat" doesn't match either,  then  the
       match fails and Perl moves to the next position in the string.  Some examples:

           "cats and dogs" =~ /cat|dog|bird/;  # matches "cat"
           "cats and dogs" =~ /dog|cat|bird/;  # matches "cat"

       Even  though  "dog"  is the first alternative in the second regexp, "cat" is able to match earlier in the
       string.

           "cats"          =~ /c|ca|cat|cats/; # matches "c"
           "cats"          =~ /cats|cat|ca|c/; # matches "cats"

       Here, all the alternatives match at the first string position, so the first alternative is the  one  that
       matches.   If  some of the alternatives are truncations of the others, put the longest ones first to give
       them a chance to match.

           "cab" =~ /a|b|c/ # matches "c"
                            # /a|b|c/ == /[abc]/

       The last example points out that character classes are like  alternations  of  characters.   At  a  given
       character  position,  the  first alternative that allows the regexp match to succeed will be the one that
       matches.

   Groupingthingsandhierarchicalmatching
       Alternation allows a regexp to choose among alternatives, but by itself it is unsatisfying.   The  reason
       is  that each alternative is a whole regexp, but sometime we want alternatives for just part of a regexp.
       For instance, suppose we want to search for housecats or housekeepers.  The regexp "housecat|housekeeper"
       fits the bill, but is inefficient because we had to type "house" twice.  It would be nice to  have  parts
       of the regexp be constant, like "house", and some parts have alternatives, like "cat|keeper".

       The  grouping metacharacters "()" solve this problem.  Grouping allows parts of a regexp to be treated as
       a single unit.  Parts of a regexp are grouped by enclosing them in parentheses.  Thus we could solve  the
       "housecat|housekeeper"  by  forming  the regexp as house(cat|keeper).  The regexp house(cat|keeper) means
       match "house" followed by either "cat" or "keeper".  Some more examples are

           /(a|b)b/;    # matches 'ab' or 'bb'
           /(ac|b)b/;   # matches 'acb' or 'bb'
           /(^a|b)c/;   # matches 'ac' at start of string or 'bc' anywhere
           /(a|[bc])d/; # matches 'ad', 'bd', or 'cd'

           /house(cat|)/;  # matches either 'housecat' or 'house'
           /house(cat(s|)|)/;  # matches either 'housecats' or 'housecat' or
                               # 'house'.  Note groups can be nested.

           /(19|20|)\d\d/;  # match years 19xx, 20xx, or the Y2K problem, xx
           "20" =~ /(19|20|)\d\d/;  # matches the null alternative '()\d\d',
                                    # because '20\d\d' can't match

       Alternations behave the same way in groups as out of them: at  a  given  string  position,  the  leftmost
       alternative  that  allows  the  regexp  to  match  is  taken.  So in the last example at the first string
       position, "20" matches the second alternative, but there is nothing left  over  to  match  the  next  two
       digits  "\d\d".   So Perl moves on to the next alternative, which is the null alternative and that works,
       since "20" is two digits.

       The process of trying one alternative, seeing if it matches, and moving on to the next alternative, while
       going back in the string from where the  previous  alternative  was  tried,  if  it  doesn't,  is  called
       backtracking.   The  term "backtracking" comes from the idea that matching a regexp is like a walk in the
       woods.  Successfully matching a regexp is like arriving  at  a  destination.   There  are  many  possible
       trailheads,  one  for  each  string  position,  and each one is tried in order, left to right.  From each
       trailhead there may be many paths, some of which get you there, and some which are dead ends.   When  you
       walk  along  a trail and hit a dead end, you have to backtrack along the trail to an earlier point to try
       another trail.  If you hit your destination, you stop immediately and forget about trying all  the  other
       trails.   You  are  persistent, and only if you have tried all the trails from all the trailheads and not
       arrived at your destination, do you declare failure.  To be concrete, here is a step-by-step analysis  of
       what Perl does when it tries to match the regexp

           "abcde" =~ /(abd|abc)(df|d|de)/;

       1.  Start with the first letter in the string 'a'.

       2.  Try the first alternative in the first group 'abd'.

       3.  Match 'a' followed by 'b'. So far so good.

       4.  'd' in the regexp doesn't match 'c' in the string - a dead end.  So backtrack two characters and pick
           the second alternative in the first group 'abc'.

       5.  Match  'a' followed by 'b' followed by 'c'.  We are on a roll and have satisfied the first group. Set
           $1 to 'abc'.

       6.  Move on to the second group and pick the first alternative 'df'.

       7.  Match the 'd'.

       8.  'f' in the regexp doesn't match 'e' in the string, so a dead end.  Backtrack one character  and  pick
           the second alternative in the second group 'd'.

       9.  'd' matches. The second grouping is satisfied, so set $2 to 'd'.

       10. We are at the end of the regexp, so we are done! We have matched 'abcd' out of the string "abcde".

       There  are  a  couple  of things to note about this analysis.  First, the third alternative in the second
       group 'de' also allows a match, but we stopped before we got to it  -  at  a  given  character  position,
       leftmost  wins.   Second,  we were able to get a match at the first character position of the string 'a'.
       If there were no matches at the first position, Perl would move to the second character position 'b'  and
       attempt  the match all over again.  Only when all possible paths at all possible character positions have
       been exhausted does Perl give up and declare "$string =~ /(abd|abc)(df|d|de)/;" to be false.

       Even with all this work, regexp matching happens remarkably fast.  To speed things up, Perl compiles  the
       regexp  into a compact sequence of opcodes that can often fit inside a processor cache.  When the code is
       executed, these opcodes can then run at full throttle and search very quickly.

   Extractingmatches
       The grouping metacharacters "()" also  serve  another  completely  different  function:  they  allow  the
       extraction  of  the parts of a string that matched.  This is very useful to find out what matched and for
       text processing in general.  For each grouping, the part  that  matched  inside  goes  into  the  special
       variables $1, $2, etc.  They can be used just as ordinary variables:

           # extract hours, minutes, seconds
           if ($time =~ /(\d\d):(\d\d):(\d\d)/) {    # match hh:mm:ss format
               $hours = $1;
               $minutes = $2;
               $seconds = $3;
           }

       Now, we know that in scalar context, "$time =~ /(\d\d):(\d\d):(\d\d)/" returns a true or false value.  In
       list  context,  however,  it returns the list of matched values "($1,$2,$3)".  So we could write the code
       more compactly as

           # extract hours, minutes, seconds
           ($hours, $minutes, $second) = ($time =~ /(\d\d):(\d\d):(\d\d)/);

       If the groupings in a regexp are nested, $1 gets the group with the leftmost opening parenthesis, $2  the
       next opening parenthesis, etc.  Here is a regexp with nested groups:

           /(ab(cd|ef)((gi)|j))/;
            1  2      34

       If  this  regexp  matches,  $1 contains a string starting with 'ab', $2 is either set to 'cd' or 'ef', $3
       equals either 'gi' or 'j', and $4 is either set to 'gi', just like $3, or it remains undefined.

       For convenience, Perl sets $+ to the string held by the highest numbered $1,  $2,...  that  got  assigned
       (and,  somewhat  related,  $^N to the value of the $1, $2,... most-recently assigned; i.e. the $1, $2,...
       associated with the rightmost closing parenthesis used in the match).

   Backreferences
       Closely associated with the matching variables $1,  $2,  ...  are  the  backreferences  "\g1",  "\g2",...
       Backreferences  are  simply  matching  variables that can be used inside a regexp.  This is a really nice
       feature; what matches later in a regexp is made to depend on what matched earlier in the regexp.  Suppose
       we wanted to look for doubled words in a text, like "the the".  The following regexp finds  all  3-letter
       doubles with a space in between:

           /\b(\w\w\w)\s\g1\b/;

       The grouping assigns a value to "\g1", so that the same 3-letter sequence is used for both parts.

       A similar task is to find words consisting of two identical parts:

           % simple_grep '^(\w\w\w\w|\w\w\w|\w\w|\w)\g1$' /usr/dict/words
           beriberi
           booboo
           coco
           mama
           murmur
           papa

       The regexp has a single grouping which considers 4-letter combinations, then 3-letter combinations, etc.,
       and  uses  "\g1"  to  look  for a repeat.  Although $1 and "\g1" represent the same thing, care should be
       taken to use matched variables $1, $2,... only outside a regexp and backreferences "\g1", "\g2",...  only
       inside a regexp; not doing so may lead to surprising and unsatisfactory results.

   Relativebackreferences
       Counting  the opening parentheses to get the correct number for a backreference is error-prone as soon as
       there is more than one capturing group.  A more convenient technique became  available  with  Perl  5.10:
       relative  backreferences. To refer to the immediately preceding capture group one now may write "\g-1" or
       "\g{-1}", the next but last is available via "\g-2" or "\g{-2}", and so on.

       Another good reason in addition to readability and maintainability for using relative  backreferences  is
       illustrated by the following example, where a simple pattern for matching peculiar strings is used:

           $a99a = '([a-z])(\d)\g2\g1';   # matches a11a, g22g, x33x, etc.

       Now that we have this pattern stored as a handy string, we might feel tempted to use it as a part of some
       other pattern:

           $line = "code=e99e";
           if ($line =~ /^(\w+)=$a99a$/){   # unexpected behavior!
               print "$1 is valid\n";
           } else {
               print "bad line: '$line'\n";
           }

       But  this  doesn't  match,  at  least not the way one might expect. Only after inserting the interpolated
       $a99a and looking at the resulting full text of the regexp is it obvious  that  the  backreferences  have
       backfired.  The  subexpression "(\w+)" has snatched number 1 and demoted the groups in $a99a by one rank.
       This can be avoided by using relative backreferences:

           $a99a = '([a-z])(\d)\g{-1}\g{-2}';  # safe for being interpolated

   Namedbackreferences
       Perl 5.10 also introduced named capture groups and named backreferences.  To attach a name to a capturing
       group, you write either "(?<name>...)" or "(?'name'...)".  The  backreference  may  then  be  written  as
       "\g{name}".  It is permissible to attach the same name to more than one group, but then only the leftmost
       one  of  the eponymous set can be referenced.  Outside of the pattern a named capture group is accessible
       through the "%+" hash.

       Assuming that we have to match calendar dates which may be given in one of the three formats  yyyy-mm-dd,
       mm/dd/yyyy or dd.mm.yyyy, we can write three suitable patterns where we use 'd', 'm' and 'y' respectively
       as the names of the groups capturing the pertaining components of a date. The matching operation combines
       the three patterns as alternatives:

           $fmt1 = '(?<y>\d\d\d\d)-(?<m>\d\d)-(?<d>\d\d)';
           $fmt2 = '(?<m>\d\d)/(?<d>\d\d)/(?<y>\d\d\d\d)';
           $fmt3 = '(?<d>\d\d)\.(?<m>\d\d)\.(?<y>\d\d\d\d)';
           for my $d (qw(2006-10-21 15.01.2007 10/31/2005)) {
               if ( $d =~ m{$fmt1|$fmt2|$fmt3} ){
                   print "day=$+{d} month=$+{m} year=$+{y}\n";
               }
           }

       If any of the alternatives matches, the hash "%+" is bound to contain the three key-value pairs.

   Alternativecapturegroupnumbering
       Yet  another  capturing  group  numbering  technique  (also  as from Perl 5.10) deals with the problem of
       referring to groups within a set of alternatives.  Consider a pattern for matching a  time  of  the  day,
       civil or military style:

           if ( $time =~ /(\d\d|\d):(\d\d)|(\d\d)(\d\d)/ ){
               # process hour and minute
           }

       Processing  the  results  requires an additional if statement to determine whether $1 and $2 or $3 and $4
       contain the goodies. It would be easier if we could use group numbers 1 and 2 in  second  alternative  as
       well, and this is exactly what the parenthesized construct "(?|...)", set around an alternative achieves.
       Here is an extended version of the previous pattern:

         if($time =~ /(?|(\d\d|\d):(\d\d)|(\d\d)(\d\d))\s+([A-Z][A-Z][A-Z])/){
             print "hour=$1 minute=$2 zone=$3\n";
         }

       Within  the  alternative  numbering group, group numbers start at the same position for each alternative.
       After the  group,  numbering  continues  with  one  higher  than  the  maximum  reached  across  all  the
       alternatives.

   Positioninformation
       In  addition to what was matched, Perl also provides the positions of what was matched as contents of the
       "@-" and "@+" arrays. "$-[0]" is the position of the start of the entire match and $+[0] is the  position
       of  the end. Similarly, "$-[n]" is the position of the start of the $n match and $+[n] is the position of
       the end. If $n is undefined, so are "$-[n]" and $+[n]. Then this code

           $x = "Mmm...donut, thought Homer";
           $x =~ /^(Mmm|Yech)\.\.\.(donut|peas)/; # matches
           foreach $exp (1..$#-) {
               no strict 'refs';
               print "Match $exp: '$$exp' at position ($-[$exp],$+[$exp])\n";
           }

       prints

           Match 1: 'Mmm' at position (0,3)
           Match 2: 'donut' at position (6,11)

       Even if there are no groupings in a regexp, it is still possible to find out what exactly  matched  in  a
       string.   If  you use them, Perl will set "$`" to the part of the string before the match, will set $& to
       the part of the string that matched, and will set "$'" to the part of the string  after  the  match.   An
       example:

           $x = "the cat caught the mouse";
           $x =~ /cat/;  # $` = 'the ', $& = 'cat', $' = ' caught the mouse'
           $x =~ /the/;  # $` = '', $& = 'the', $' = ' cat caught the mouse'

       In  the  second  match,  "$`" equals '' because the regexp matched at the first character position in the
       string and stopped; it never saw the second "the".

       If your code is to run on Perl versions earlier than 5.20, it is worthwhile to note that using  "$`"  and
       "$'"  slows  down regexp matching quite a bit, while $& slows it down to a lesser extent, because if they
       are used in one regexp in a program, they are generated for all  regexps  in  the  program.   So  if  raw
       performance  is  a  goal  of  your  application,  they  should  be  avoided.   If you need to extract the
       corresponding substrings, use "@-" and "@+" instead:

           $` is the same as substr( $x, 0, $-[0] )
           $& is the same as substr( $x, $-[0], $+[0]-$-[0] )
           $' is the same as substr( $x, $+[0] )

       As of Perl 5.10, the "${^PREMATCH}", "${^MATCH}" and "${^POSTMATCH}" variables may be  used.   These  are
       only set if the "/p" modifier is present.  Consequently they do not penalize the rest of the program.  In
       Perl  5.20,  "${^PREMATCH}", "${^MATCH}" and "${^POSTMATCH}" are available whether the "/p" has been used
       or not (the modifier is ignored), and "$`", "$'" and $& do not cause any speed difference.

   Non-capturinggroupings
       A group that is required to bundle a set of alternatives may or may not be useful as a  capturing  group.
       If  it isn't, it just creates a superfluous addition to the set of available capture group values, inside
       as well as outside the regexp.  Non-capturing groupings, denoted by "(?:regexp)", still allow the  regexp
       to  be  treated as a single unit, but don't establish a capturing group at the same time.  Both capturing
       and non-capturing groupings are allowed to co-exist in the same regexp.  Because there is no  extraction,
       non-capturing  groupings are faster than capturing groupings.  Non-capturing groupings are also handy for
       choosing exactly which parts of a regexp are to be extracted to matching variables:

           # match a number, $1-$4 are set, but we only want $1
           /([+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?)/;

           # match a number faster , only $1 is set
           /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE][+-]?\d+)?)/;

           # match a number, get $1 = whole number, $2 = exponent
           /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE]([+-]?\d+))?)/;

       Non-capturing groupings are also useful for removing nuisance elements gathered from  a  split  operation
       where parentheses are required for some reason:

           $x = '12aba34ba5';
           @num = split /(a|b)+/, $x;    # @num = ('12','a','34','a','5')
           @num = split /(?:a|b)+/, $x;  # @num = ('12','34','5')

       In  Perl  5.22  and  later,  all groups within a regexp can be set to non-capturing by using the new "/n"
       flag:

           "hello" =~ /(hi|hello)/n; # $1 is not set!

       See "n" in perlre for more information.

   Matchingrepetitions
       The examples in the previous section display an annoying weakness.  We were only matching 3-letter words,
       or chunks of words of 4 letters or less.  We'd like to be able to match words or, more generally, strings
       of any length, without writing out tedious alternatives like "\w\w\w\w|\w\w\w|\w\w|\w".

       This is exactly the problem the quantifier metacharacters '?', '*', '+', and "{}" were created for.  They
       allow us to delimit the number of repeats for  a  portion  of  a  regexp  we  consider  to  be  a  match.
       Quantifiers  are  put  immediately  after  the  character,  character  class, or grouping that we want to
       specify.  They have the following meanings:

       •   "a?" means: match 'a' 1 or 0 times

       •   "a*" means: match 'a' 0 or more times, i.e., any number of times

       •   "a+" means: match 'a' 1 or more times, i.e., at least once

       •   "a{n,m}" means: match at least "n" times, but not more than "m" times.

       •   "a{n,}" means: match at least "n" or more times

       •   "a{,n}" means: match at most "n" times, or fewer

       •   "a{n}" means: match exactly "n" times

       If you like, you can add blanks (tab or space characters) within the braces, but adjacent to them, and/or
       next to the comma (if any).

       Here are some examples:

           /[a-z]+\s+\d*/;  # match a lowercase word, at least one space, and
                            # any number of digits
           /(\w+)\s+\g1/;    # match doubled words of arbitrary length
           /y(es)?/i;       # matches 'y', 'Y', or a case-insensitive 'yes'
           $year =~ /^\d{2,4}$/;  # make sure year is at least 2 but not more
                                  # than 4 digits
           $year =~ /^\d{ 2, 4 }$/;    # Same; for those who like wide open
                                       # spaces.
           $year =~ /^\d{2, 4}$/;      # Same.
           $year =~ /^\d{4}$|^\d{2}$/; # better match; throw out 3-digit dates
           $year =~ /^\d{2}(\d{2})?$/; # same thing written differently.
                                       # However, this captures the last two
                                       # digits in $1 and the other does not.

           % simple_grep '^(\w+)\g1$' /usr/dict/words   # isn't this easier?
           beriberi
           booboo
           coco
           mama
           murmur
           papa

       For all of these quantifiers, Perl will try to match as much of  the  string  as  possible,  while  still
       allowing  the  regexp  to succeed.  Thus with "/a?.../", Perl will first try to match the regexp with the
       'a' present; if that fails, Perl will try  to  match  the  regexp  without  the  'a'  present.   For  the
       quantifier '*', we get the following:

           $x = "the cat in the hat";
           $x =~ /^(.*)(cat)(.*)$/; # matches,
                                    # $1 = 'the '
                                    # $2 = 'cat'
                                    # $3 = ' in the hat'

       Which is what we might expect, the match finds the only "cat" in the string and locks onto it.  Consider,
       however, this regexp:

           $x =~ /^(.*)(at)(.*)$/; # matches,
                                   # $1 = 'the cat in the h'
                                   # $2 = 'at'
                                   # $3 = ''   (0 characters match)

       One  might  initially guess that Perl would find the "at" in "cat" and stop there, but that wouldn't give
       the longest possible string to the first quantifier ".*".  Instead, the first quantifier  ".*"  grabs  as
       much  of  the string as possible while still having the regexp match.  In this example, that means having
       the "at" sequence with the final "at" in the string.  The other important principle illustrated  here  is
       that,  when there are two or more elements in a regexp, the leftmost quantifier, if there is one, gets to
       grab as much of the string as possible, leaving the rest of the regexp to fight over scraps.  Thus in our
       example, the first quantifier ".*" grabs most of the string, while the second quantifier  ".*"  gets  the
       empty  string.    Quantifiers  that  grab  as  much of the string as possible are called maximalmatch or
       greedy quantifiers.

       When a regexp can match a string in several different ways, we can use the principles  above  to  predict
       which way the regexp will match:

       •   Principle  0:  Taken  as a whole, any regexp will be matched at the earliest possible position in the
           string.

       •   Principle 1: In an alternation "a|b|c...", the leftmost alternative that allows a match for the whole
           regexp will be the one used.

       •   Principle 2: The maximal matching quantifiers '?', '*', '+' and "{n,m}" will in general match as much
           of the string as possible while still allowing the whole regexp to match.

       •   Principle 3: If there are two or more elements in a regexp, the leftmost greedy quantifier,  if  any,
           will  match  as  much  of the string as possible while still allowing the whole regexp to match.  The
           next leftmost greedy quantifier, if any, will try to match as much of the string remaining  available
           to  it  as possible, while still allowing the whole regexp to match.  And so on, until all the regexp
           elements are satisfied.

       As we have seen above, Principle 0 overrides the others. The regexp will be matched as early as possible,
       with the other principles determining how the regexp matches at that earliest character position.

       Here is an example of these principles in action:

           $x = "The programming republic of Perl";
           $x =~ /^(.+)(e|r)(.*)$/;  # matches,
                                     # $1 = 'The programming republic of Pe'
                                     # $2 = 'r'
                                     # $3 = 'l'

       This regexp matches at the earliest string position, 'T'.  One might think that 'e',  being  leftmost  in
       the alternation, would be matched, but 'r' produces the longest string in the first quantifier.

           $x =~ /(m{1,2})(.*)$/;  # matches,
                                   # $1 = 'mm'
                                   # $2 = 'ing republic of Perl'

       Here, The earliest possible match is at the first 'm' in "programming". "m{1,2}" is the first quantifier,
       so it gets to match a maximal "mm".

           $x =~ /.*(m{1,2})(.*)$/;  # matches,
                                     # $1 = 'm'
                                     # $2 = 'ing republic of Perl'

       Here, the regexp matches at the start of the string. The first quantifier ".*" grabs as much as possible,
       leaving just a single 'm' for the second quantifier "m{1,2}".

           $x =~ /(.?)(m{1,2})(.*)$/;  # matches,
                                       # $1 = 'a'
                                       # $2 = 'mm'
                                       # $3 = 'ing republic of Perl'

       Here,  ".?"  eats  its  maximal  one  character  at  the earliest possible position in the string, 'a' in
       "programming", leaving "m{1,2}" the opportunity to match both 'm''s. Finally,

           "aXXXb" =~ /(X*)/; # matches with $1 = ''

       because it can match zero copies of 'X' at the beginning of the string.  If you definitely want to  match
       at least one 'X', use "X+", not "X*".

       Sometimes  greed  is  not  good.  At times, we would like quantifiers to match a minimal piece of string,
       rather than a maximal piece.  For this purpose, Larry  Wall  created  the  minimalmatch  or  non-greedy
       quantifiers  "??",  "*?",  "+?", and "{}?".  These are the usual quantifiers with a '?' appended to them.
       They have the following meanings:

       •   "a??" means: match 'a' 0 or 1 times. Try 0 first, then 1.

       •   "a*?" means: match 'a' 0 or more times, i.e., any number of times, but as few times as possible

       •   "a+?" means: match 'a' 1 or more times, i.e., at least once, but as few times as possible

       •   "a{n,m}?" means: match at least "n" times, not more than "m" times, as few times as possible

       •   "a{n,}?" means: match at least "n" times, but as few times as possible

       •   "a{,n}?" means: match at most "n" times, but as few times as possible

       •   "a{n}?" means: match exactly "n" times.  Because we match exactly "n" times, "a{n}?" is equivalent to
           "a{n}" and is just there for notational consistency.

       Let's look at the example above, but with minimal quantifiers:

           $x = "The programming republic of Perl";
           $x =~ /^(.+?)(e|r)(.*)$/; # matches,
                                     # $1 = 'Th'
                                     # $2 = 'e'
                                     # $3 = ' programming republic of Perl'

       The minimal string that will allow both the start of the string '^' and the alternation to match is "Th",
       with the alternation "e|r" matching 'e'.  The second quantifier ".*" is free to gobble up the rest of the
       string.

           $x =~ /(m{1,2}?)(.*?)$/;  # matches,
                                     # $1 = 'm'
                                     # $2 = 'ming republic of Perl'

       The first string position that this regexp can match is at  the  first  'm'  in  "programming".  At  this
       position, the minimal "m{1,2}?"  matches just one 'm'.  Although the second quantifier ".*?" would prefer
       to  match  no  characters,  it  is  constrained  by the end-of-string anchor '$' to match the rest of the
       string.

           $x =~ /(.*?)(m{1,2}?)(.*)$/;  # matches,
                                         # $1 = 'The progra'
                                         # $2 = 'm'
                                         # $3 = 'ming republic of Perl'

       In this regexp, you might expect the first minimal quantifier ".*?"  to match the empty  string,  because
       it  is  not  constrained  by  a '^' anchor to match the beginning of the word.  Principle 0 applies here,
       however.  Because it is possible for the whole regexp to match at the start of the string, it will  match
       at  the start of the string.  Thus the first quantifier has to match everything up to the first 'm'.  The
       second minimal quantifier matches just one 'm' and the third quantifier matches the rest of the string.

           $x =~ /(.??)(m{1,2})(.*)$/;  # matches,
                                        # $1 = 'a'
                                        # $2 = 'mm'
                                        # $3 = 'ing republic of Perl'

       Just as in the previous regexp, the first quantifier ".??" can match earliest  at  position  'a',  so  it
       does.  The second quantifier is greedy, so it matches "mm", and the third matches the rest of the string.

       We can modify principle 3 above to take into account non-greedy quantifiers:

       •   Principle  3:  If  there  are  two  or  more  elements  in a regexp, the leftmost greedy (non-greedy)
           quantifier, if any, will match as much (little) of the string as possible while  still  allowing  the
           whole  regexp  to match.  The next leftmost greedy (non-greedy) quantifier, if any, will try to match
           as much (little) of the string remaining available to it as possible, while still allowing the  whole
           regexp to match.  And so on, until all the regexp elements are satisfied.

       Just like alternation, quantifiers are also susceptible to backtracking.  Here is a step-by-step analysis
       of the example

           $x = "the cat in the hat";
           $x =~ /^(.*)(at)(.*)$/; # matches,
                                   # $1 = 'the cat in the h'
                                   # $2 = 'at'
                                   # $3 = ''   (0 matches)

       1.  Start with the first letter in the string 't'.

       2.  The first quantifier '.*' starts out by matching the whole string "the cat in the hat".

       3.  'a' in the regexp element 'at' doesn't match the end of the string.  Backtrack one character.

       4.  'a'  in  the  regexp element 'at' still doesn't match the last letter of the string 't', so backtrack
           one more character.

       5.  Now we can match the 'a' and the 't'.

       6.  Move on to the third element '.*'.  Since we are at the end of the string and '.*' can match 0 times,
           assign it the empty string.

       7.  We are done!

       Most of the time, all this moving forward and backtracking happens quickly and searching is  fast.  There
       are  some  pathological  regexps,  however, whose execution time exponentially grows with the size of the
       string.  A typical structure that blows up in your face is of the form

           /(a|b+)*/;

       The problem is the nested indeterminate quantifiers.  There are many different  ways  of  partitioning  a
       string  of  length  n between the '+' and '*': one repetition with "b+" of length n, two repetitions with
       the first "b+" length k and the second with length n-k, m repetitions whose bits add up to length n, etc.
       In fact there are an exponential number of ways to partition a string as a function  of  its  length.   A
       regexp  may  get  lucky  and  match  early  in the process, but if there is no match, Perl will try every
       possibility before giving up.  So be careful with nested '*''s, "{n,m}"'s, and '+''s.  The book MasteringRegularExpressions by Jeffrey Friedl gives a wonderful discussion of this and other efficiency issues.

   Possessivequantifiers
       Backtracking during the relentless search for a match may be a waste of time, particularly when the match
       is bound to fail.  Consider the simple pattern

           /^\w+\s+\w+$/; # a word, spaces, a word

       Whenever this is applied to a string which doesn't quite meet the pattern's expectations such as  "abc  "
       or  "abc  def ",  the  regexp engine will backtrack, approximately once for each character in the string.
       But we know that there is no way around taking all of the initial word  characters  to  match  the  first
       repetition, that all spaces must be eaten by the middle part, and the same goes for the second word.

       With the introduction of the possessivequantifiers in Perl 5.10, we have a way of instructing the regexp
       engine  not to backtrack, with the usual quantifiers with a '+' appended to them.  This makes them greedy
       as well as stingy; once they succeed they won't give anything back to permit another solution. They  have
       the following meanings:

       •   "a{n,m}+"  means:  match  at least "n" times, not more than "m" times, as many times as possible, and
           don't give anything up. "a?+" is short for "a{0,1}+"

       •   "a{n,}+" means: match at least "n" times, but as many times as possible, and don't give anything  up.
           "a++" is short for "a{1,}+".

       •   "a{,n}+"  means: match as many times as possible up to at most "n" times, and don't give anything up.
           "a*+" is short for "a{0,}+".

       •   "a{n}+" means: match exactly "n" times.  It is just there for notational consistency.

       These possessive quantifiers represent a  special  case  of  a  more  general  concept,  the  independentsubexpression, see below.

       As  an  example  where  a  possessive  quantifier is suitable we consider matching a quoted string, as it
       appears in several programming languages.  The backslash is used as an escape  character  that  indicates
       that  the next character is to be taken literally, as another character for the string.  Therefore, after
       the opening quote, we expect a (possibly empty) sequence of alternatives: either some character except an
       unescaped quote or backslash or an escaped character.

           /"(?:[^"\\]++|\\.)*+"/;

   Buildingaregexp
       At this point, we have all the basic regexp concepts covered, so let's give a more involved example of  a
       regular expression.  We will build a regexp that matches numbers.

       The  first  task in building a regexp is to decide what we want to match and what we want to exclude.  In
       our case, we want to match both integers and floating point numbers and we want to reject any string that
       isn't a number.

       The next task is to break the problem down into smaller problems that are easily converted into a regexp.

       The simplest case is integers.  These consist of a sequence of digits, with an optional  sign  in  front.
       The  digits we can represent with "\d+" and the sign can be matched with "[+-]".  Thus the integer regexp
       is

           /[+-]?\d+/;  # matches integers

       A floating point number potentially has a sign, an integral part, a decimal point, a fractional part, and
       an exponent.  One or  more  of  these  parts  is  optional,  so  we  need  to  check  out  the  different
       possibilities.   Floating  point  numbers  which  are  in proper form include 123., 0.345, .34, -1e6, and
       25.4E-72.  As with integers, the sign out front is completely optional and can be matched by "[+-]?".  We
       can see that if there is no exponent, floating point numbers must have a decimal  point,  otherwise  they
       are  integers.   We  might  be  tempted  to model these with "\d*\.\d*", but this would also match just a
       single decimal point, which is not a number.  So  the  three  cases  of  floating  point  number  without
       exponent are

          /[+-]?\d+\./;  # 1., 321., etc.
          /[+-]?\.\d+/;  # .1, .234, etc.
          /[+-]?\d+\.\d+/;  # 1.0, 30.56, etc.

       These can be combined into a single regexp with a three-way alternation:

          /[+-]?(\d+\.\d+|\d+\.|\.\d+)/;  # floating point, no exponent

       In this alternation, it is important to put '\d+\.\d+' before '\d+\.'.  If '\d+\.' were first, the regexp
       would happily match that and ignore the fractional part of the number.

       Now  consider  floating point numbers with exponents.  The key observation here is that both integers and
       numbers with decimal points are allowed in front of an exponent.  Then exponents, like the overall  sign,
       are independent of whether we are matching numbers with or without decimal points, and can be "decoupled"
       from the mantissa.  The overall form of the regexp now becomes clear:

           /^(optional sign)(integer | f.p. mantissa)(optional exponent)$/;

       The exponent is an 'e' or 'E', followed by an integer.  So the exponent regexp is

          /[eE][+-]?\d+/;  # exponent

       Putting all the parts together, we get a regexp that matches numbers:

          /^[+-]?(\d+\.\d+|\d+\.|\.\d+|\d+)([eE][+-]?\d+)?$/;  # Ta da!

       Long regexps like this may impress your friends, but can be hard to decipher.  In complex situations like
       this,  the "/x" modifier for a match is invaluable.  It allows one to put nearly arbitrary whitespace and
       comments into a regexp without affecting their meaning.  Using it, we can rewrite our  "extended"  regexp
       in the more pleasing form

          /^
             [+-]?         # first, match an optional sign
             (             # then match integers or f.p. mantissas:
                 \d+\.\d+  # mantissa of the form a.b
                |\d+\.     # mantissa of the form a.
                |\.\d+     # mantissa of the form .b
                |\d+       # integer of the form a
             )
             ( [eE] [+-]? \d+ )?  # finally, optionally match an exponent
          $/x;

       If  whitespace  is  mostly  irrelevant,  how does one include space characters in an extended regexp? The
       answer is to backslash it '\ ' or put it in a character class "[ ]".   The  same  thing  goes  for  pound
       signs:  use  "\#"  or  "[#]".   For  instance,  Perl  allows a space between the sign and the mantissa or
       integer, and we could add this to our regexp as follows:

          /^
             [+-]?\ *      # first, match an optional sign *and space*
             (             # then match integers or f.p. mantissas:
                 \d+\.\d+  # mantissa of the form a.b
                |\d+\.     # mantissa of the form a.
                |\.\d+     # mantissa of the form .b
                |\d+       # integer of the form a
             )
             ( [eE] [+-]? \d+ )?  # finally, optionally match an exponent
          $/x;

       In this form, it is easier to see a way to simplify the alternation.  Alternatives 1, 2, and 4 all  start
       with "\d+", so it could be factored out:

          /^
             [+-]?\ *      # first, match an optional sign
             (             # then match integers or f.p. mantissas:
                 \d+       # start out with a ...
                 (
                     \.\d* # mantissa of the form a.b or a.
                 )?        # ? takes care of integers of the form a
                |\.\d+     # mantissa of the form .b
             )
             ( [eE] [+-]? \d+ )?  # finally, optionally match an exponent
          $/x;

       Starting  in  Perl  v5.26,  specifying "/xx" changes the square-bracketed portions of a pattern to ignore
       tabs and space characters unless they are escaped by preceding them with a backslash.  So, we could write

          /^
             [ + - ]?\ *   # first, match an optional sign
             (             # then match integers or f.p. mantissas:
                 \d+       # start out with a ...
                 (
                     \.\d* # mantissa of the form a.b or a.
                 )?        # ? takes care of integers of the form a
                |\.\d+     # mantissa of the form .b
             )
             ( [ e E ] [ + - ]? \d+ )?  # finally, optionally match an exponent
          $/xx;

       This doesn't really improve the legibility of this example, but it's  available  in  case  you  want  it.
       Squashing the pattern down to the compact form, we have

           /^[+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?$/;

       This is our final regexp.  To recap, we built a regexp by

       •   specifying the task in detail,

       •   breaking down the problem into smaller parts,

       •   translating the small parts into regexps,

       •   combining the regexps,

       •   and optimizing the final combined regexp.

       These  are  also  the  typical  steps  involved in writing a computer program.  This makes perfect sense,
       because regular expressions are essentially programs written in a little computer language that specifies
       patterns.

   UsingregularexpressionsinPerl
       The last topic of Part 1 briefly covers how regexps are used in Perl programs.  Where do  they  fit  into
       Perl syntax?

       We  have  already  introduced  the  matching  operator  in its default "/regexp/" and arbitrary delimiter
       "m!regexp!" forms.  We have used the binding operator "=~" and its  negation  "!~"  to  test  for  string
       matches.  Associated with the matching operator, we have discussed the single line "/s", multi-line "/m",
       case-insensitive  "/i"  and  extended "/x" modifiers.  There are a few more things you might want to know
       about matching operators.

       Prohibitingsubstitution

       If you change $pattern after the first substitution happens, Perl will ignore it.  If you don't want  any
       substitutions at all, use the special delimiter "m''":

           @pattern = ('Seuss');
           while (<>) {
               print if m'@pattern';  # matches literal '@pattern', not 'Seuss'
           }

       Similar  to  strings,  "m''" acts like apostrophes on a regexp; all other 'm' delimiters act like quotes.
       If the regexp evaluates to the empty string, the regexp in the lastsuccessfulmatch is used instead.  So
       we have

           "dog" =~ /d/;  # 'd' matches
           "dogbert" =~ //;  # this matches the 'd' regexp used before

       Globalmatching

       The final two modifiers we will discuss here, "/g" and "/c", concern multiple matches.  The modifier "/g"
       stands for global matching and allows the matching operator to match within a string  as  many  times  as
       possible.   In  scalar context, successive invocations against a string will have "/g" jump from match to
       match, keeping track of position in the string as it goes along.  You can get or set  the  position  with
       the pos() function.

       The  use  of  "/g"  is  shown  in the following example.  Suppose we have a string that consists of words
       separated by spaces.  If we know how many words there are in advance, we could extract  the  words  using
       groupings:

           $x = "cat dog house"; # 3 words
           $x =~ /^\s*(\w+)\s+(\w+)\s+(\w+)\s*$/; # matches,
                                                  # $1 = 'cat'
                                                  # $2 = 'dog'
                                                  # $3 = 'house'

       But  what  if  we  had  an indeterminate number of words? This is the sort of task "/g" was made for.  To
       extract all words, form the simple regexp "(\w+)" and loop over all matches with "/(\w+)/g":

           while ($x =~ /(\w+)/g) {
               print "Word is $1, ends at position ", pos $x, "\n";
           }

       prints

           Word is cat, ends at position 3
           Word is dog, ends at position 7
           Word is house, ends at position 13

       A failed match or changing the target string resets the position.  If you don't want the  position  reset
       after  failure  to  match,  add  the  "/c",  as  in  "/regexp/gc".  The current position in the string is
       associated with the string, not the regexp.  This means that different strings have  different  positions
       and their respective positions can be set or read independently.

       In  list  context,  "/g"  returns  a  list  of matched groupings, or if there are no groupings, a list of
       matches to the whole regexp.  So if we wanted just the words, we could use

           @words = ($x =~ /(\w+)/g);  # matches,
                                       # $words[0] = 'cat'
                                       # $words[1] = 'dog'
                                       # $words[2] = 'house'

       Closely associated with the "/g" modifier is the "\G" anchor.  The "\G" anchor matches at the point where
       the previous "/g" match left off.  "\G" allows us to easily do context-sensitive matching:

           $metric = 1;  # use metric units
           ...
           $x = <FILE>;  # read in measurement
           $x =~ /^([+-]?\d+)\s*/g;  # get magnitude
           $weight = $1;
           if ($metric) { # error checking
               print "Units error!" unless $x =~ /\Gkg\./g;
           }
           else {
               print "Units error!" unless $x =~ /\Glbs\./g;
           }
           $x =~ /\G\s+(widget|sprocket)/g;  # continue processing

       The combination of "/g" and "\G" allows us to process the string a bit at a time and use  arbitrary  Perl
       logic  to decide what to do next.  Currently, the "\G" anchor is only fully supported when used to anchor
       to the start of the pattern.

       "\G" is also invaluable in processing fixed-length records with regexps.  Suppose we have  a  snippet  of
       coding  region  DNA, encoded as base pair letters "ATCGTTGAAT..." and we want to find all the stop codons
       "TGA".  In a coding region, codons are 3-letter sequences, so we can  think  of  the  DNA  snippet  as  a
       sequence of 3-letter records.  The naive regexp

           # expanded, this is "ATC GTT GAA TGC AAA TGA CAT GAC"
           $dna = "ATCGTTGAATGCAAATGACATGAC";
           $dna =~ /TGA/;

       doesn't  work;  it  may  match  a  "TGA",  but there is no guarantee that the match is aligned with codon
       boundaries, e.g., the substring "GTT GAA" gives a match.  A better solution is

           while ($dna =~ /(\w\w\w)*?TGA/g) {  # note the minimal *?
               print "Got a TGA stop codon at position ", pos $dna, "\n";
           }

       which prints

           Got a TGA stop codon at position 18
           Got a TGA stop codon at position 23

       Position 18 is good, but position 23 is bogus.  What happened?

       The answer is that our regexp works well until we get past the last real match.   Then  the  regexp  will
       fail to match a synchronized "TGA" and start stepping ahead one character position at a time, not what we
       want.  The solution is to use "\G" to anchor the match to the codon alignment:

           while ($dna =~ /\G(\w\w\w)*?TGA/g) {
               print "Got a TGA stop codon at position ", pos $dna, "\n";
           }

       This prints

           Got a TGA stop codon at position 18

       which  is  the  correct  answer.  This example illustrates that it is important not only to match what is
       desired, but to reject what is not desired.

       (There are other regexp modifiers that are available, such as "/o", but their specialized uses are beyond
       the scope of this introduction.  )

       Searchandreplace

       Regular expressions also play a big role in searchandreplace operations in Perl.  Search and replace is
       accomplished with the "s///"  operator.   The  general  form  is  "s/regexp/replacement/modifiers",  with
       everything  we know about regexps and modifiers applying in this case as well.  The replacement is a Perl
       double-quoted string that replaces in the string whatever is matched with  the  "regexp".   The  operator
       "=~"  is  also  used  here to associate a string with "s///".  If matching against $_, the "$_ =~" can be
       dropped.  If there is a match, "s///" returns the number of  substitutions  made;  otherwise  it  returns
       false.  Here are a few examples:

           $x = "Time to feed the cat!";
           $x =~ s/cat/hacker/;   # $x contains "Time to feed the hacker!"
           if ($x =~ s/^(Time.*hacker)!$/$1 now!/) {
               $more_insistent = 1;
           }
           $y = "'quoted words'";
           $y =~ s/^'(.*)'$/$1/;  # strip single quotes,
                                  # $y contains "quoted words"

       In  the  last  example,  the  whole  string  was  matched, but only the part inside the single quotes was
       grouped.  With the "s///" operator, the matched variables $1, $2, etc. are immediately available for  use
       in the replacement expression, so we use $1 to replace the quoted string with just what was quoted.  With
       the global modifier, "s///g" will search and replace all occurrences of the regexp in the string:

           $x = "I batted 4 for 4";
           $x =~ s/4/four/;   # doesn't do it all:
                              # $x contains "I batted four for 4"
           $x = "I batted 4 for 4";
           $x =~ s/4/four/g;  # does it all:
                              # $x contains "I batted four for four"

       If you prefer "regex" over "regexp" in this tutorial, you could use the following program to replace it:

           % cat > simple_replace
           #!/usr/bin/perl
           $regexp = shift;
           $replacement = shift;
           while (<>) {
               s/$regexp/$replacement/g;
               print;
           }
           ^D

           % simple_replace regexp regex perlretut.pod

       In  "simple_replace"  we used the "s///g" modifier to replace all occurrences of the regexp on each line.
       (Even though the regular expression appears in a loop, Perl is smart enough to compile it only once.)  As
       with "simple_grep", both the "print" and the "s/$regexp/$replacement/g" use $_ implicitly.

       If you don't want "s///" to change your original variable you  can  use  the  non-destructive  substitute
       modifier,  "s///r".   This  changes  the  behavior  so  that "s///r" returns the final substituted string
       (instead of the number of substitutions):

           $x = "I like dogs.";
           $y = $x =~ s/dogs/cats/r;
           print "$x $y\n";

       That example will print "I like dogs. I like  cats".  Notice  the  original  $x  variable  has  not  been
       affected.  The  overall  result  of the substitution is instead stored in $y. If the substitution doesn't
       affect anything then the original string is returned:

           $x = "I like dogs.";
           $y = $x =~ s/elephants/cougars/r;
           print "$x $y\n"; # prints "I like dogs. I like dogs."

       One other interesting thing that the "s///r" flag allows is chaining substitutions:

           $x = "Cats are great.";
           print $x =~ s/Cats/Dogs/r =~ s/Dogs/Frogs/r =~
               s/Frogs/Hedgehogs/r, "\n";
           # prints "Hedgehogs are great."

       A modifier available specifically to search and replace is  the  "s///e"  evaluation  modifier.   "s///e"
       treats  the  replacement  text as Perl code, rather than a double-quoted string.  The value that the code
       returns is substituted for the matched substring.  "s///e"  is  useful  if  you  need  to  do  a  bit  of
       computation in the process of replacing text.  This example counts character frequencies in a line:

           $x = "Bill the cat";
           $x =~ s/(.)/$chars{$1}++;$1/eg; # final $1 replaces char with itself
           print "frequency of '$_' is $chars{$_}\n"
               foreach (sort {$chars{$b} <=> $chars{$a}} keys %chars);

       This prints

           frequency of ' ' is 2
           frequency of 't' is 2
           frequency of 'l' is 2
           frequency of 'B' is 1
           frequency of 'c' is 1
           frequency of 'e' is 1
           frequency of 'h' is 1
           frequency of 'i' is 1
           frequency of 'a' is 1

       As  with  the match "m//" operator, "s///" can use other delimiters, such as "s!!!" and "s{}{}", and even
       "s{}//".  If single quotes are used "s'''", then the regexp and replacement are treated as  single-quoted
       strings  and  there  are  no variable substitutions.  "s///" in list context returns the same thing as in
       scalar context, i.e., the number of matches.

       Thesplitfunction

       The split() function is another place where a regexp is used.  "split /regexp/, string, limit"  separates
       the  "string"  operand  into  a list of substrings and returns that list.  The regexp must be designed to
       match whatever constitutes  the  separators  for  the  desired  substrings.   The  "limit",  if  present,
       constrains  splitting  into  no more than "limit" number of strings.  For example, to split a string into
       words, use

           $x = "Calvin and Hobbes";
           @words = split /\s+/, $x;  # $word[0] = 'Calvin'
                                      # $word[1] = 'and'
                                      # $word[2] = 'Hobbes'

       If the empty regexp "//" is used, the regexp always matches and  the  string  is  split  into  individual
       characters.   If  the  regexp has groupings, then the resulting list contains the matched substrings from
       the groupings as well.  For instance,

           $x = "/usr/bin/perl";
           @dirs = split m!/!, $x;  # $dirs[0] = ''
                                    # $dirs[1] = 'usr'
                                    # $dirs[2] = 'bin'
                                    # $dirs[3] = 'perl'
           @parts = split m!(/)!, $x;  # $parts[0] = ''
                                       # $parts[1] = '/'
                                       # $parts[2] = 'usr'
                                       # $parts[3] = '/'
                                       # $parts[4] = 'bin'
                                       # $parts[5] = '/'
                                       # $parts[6] = 'perl'

       Since the first character of $x matched the regexp, "split" prepended an empty  initial  element  to  the
       list.

       If  you  have  read  this  far,  congratulations!  You now have all the basic tools needed to use regular
       expressions to solve a wide range of text processing problems.  If this is your first  time  through  the
       tutorial,  why  not stop here and play around with regexps a while....  Part 2 concerns the more esoteric
       aspects of regular expressions and those concepts certainly aren't needed right at the start.

Part 2: Power Tools

       OK, you know the basics of regexps and you want  to  know  more.   If  matching  regular  expressions  is
       analogous  to  a  walk  in the woods, then the tools discussed in Part 1 are analogous to topo maps and a
       compass, basic tools we use all the time.  Most of the tools in part 2 are analogous to  flare  guns  and
       satellite phones.  They aren't used too often on a hike, but when we are stuck, they can be invaluable.

       What  follows  are  the more advanced, less used, or sometimes esoteric capabilities of Perl regexps.  In
       Part 2, we will assume you are comfortable with the basics and concentrate on the advanced features.

   Moreoncharacters,strings,andcharacterclasses
       There are a number of escape sequences and character classes that we haven't covered yet.

       There are several escape sequences that convert characters or strings between upper and lower  case,  and
       they  are  also  available  within  patterns.  "\l" and "\u" convert the next character to lower or upper
       case, respectively:

           $x = "perl";
           $string =~ /\u$x/;  # matches 'Perl' in $string
           $x = "M(rs?|s)\\."; # note the double backslash
           $string =~ /\l$x/;  # matches 'mr.', 'mrs.', and 'ms.',

       A "\L" or "\U" indicates a lasting conversion of case, until terminated by "\E" or thrown over by another
       "\U" or "\L":

           $x = "This word is in lower case:\L SHOUT\E";
           $x =~ /shout/;       # matches
           $x = "I STILL KEYPUNCH CARDS FOR MY 360";
           $x =~ /\Ukeypunch/;  # matches punch card string

       If there is no "\E", case is  converted  until  the  end  of  the  string.  The  regexps  "\L\u$word"  or
       "\u\L$word"  convert  the  first  character  of  $word  to  uppercase  and  the rest of the characters to
       lowercase.  (Beyond ASCII characters, it gets somewhat more complicated; "\u" actually performs titlecase
       mapping,  which  for  most  characters   is   the   same   as   uppercase,   but   not   for   all;   see
       <https://unicode.org/faq/casemap_charprop.html#4>.)

       Control  characters  can be escaped with "\c", so that a control-Z character would be matched with "\cZ".
       The escape sequence "\Q"..."\E" quotes, or protects most non-alphabetic characters.   For instance,

           $x = "\QThat !^*&%~& cat!";
           $x =~ /\Q!^*&%~&\E/;  # check for rough language

       It does not protect '$' or '@', so that variables can still be substituted.

       "\Q", "\L", "\l", "\U", "\u" and "\E" are actually part of double-quotish syntax, and not part of  regexp
       syntax proper.  They will work if they appear in a regular expression embedded directly in a program, but
       not when contained in a string that is interpolated in a pattern.

       Perl  regexps  can  handle  more  than  just  the standard ASCII character set.  Perl supports Unicode, a
       standard for representing the alphabets from virtually all of the world's written languages, and  a  host
       of  symbols.   Perl's  text  strings  are  Unicode  strings,  so they can contain characters with a value
       (codepoint or character number) higher than 255.

       What does this mean for regexps? Well, regexp users  don't  need  to  know  much  about  Perl's  internal
       representation  of  strings.  But they do need to know 1) how to represent Unicode characters in a regexp
       and 2) that a matching operation will treat the string to be searched as a sequence  of  characters,  not
       bytes.   The  answer  to  1)  is  that Unicode characters greater than chr(255) are represented using the
       "\x{hex}" notation, because "\x"XY (without curly braces and XY are two hex digits)  doesn't  go  further
       than 255.  (Starting in Perl 5.14, if you're an octal fan, you can also use "\o{oct}".)

           /\x{263a}/;   # match a Unicode smiley face :)
           /\x{ 263a }/; # Same

       NOTE: In Perl 5.6.0 it used to be that one needed to say "use utf8" to use any Unicode features.  This is
       no  longer  the  case: for almost all Unicode processing, the explicit "utf8" pragma is not needed.  (The
       only case where it matters is if your Perl script is in Unicode and encoded in UTF-8,  then  an  explicit
       "use utf8" is needed.)

       Figuring  out  the  hexadecimal  sequence  of  a Unicode character you want or deciphering someone else's
       hexadecimal Unicode regexp is about as much fun as programming  in  machine  code.   So  another  way  to
       specify  Unicode characters is to use the namedcharacter escape sequence "\N{name}".  name is a name for
       the Unicode character, as specified in the Unicode standard.  For instance, if we wanted to represent  or
       match the astrological sign for the planet Mercury, we could use

           $x = "abc\N{MERCURY}def";
           $x =~ /\N{MERCURY}/;   # matches
           $x =~ /\N{ MERCURY }/; # Also matches

       One can also use "short" names:

           print "\N{GREEK SMALL LETTER SIGMA} is called sigma.\n";
           print "\N{greek:Sigma} is an upper-case sigma.\n";

       You can also restrict names to a certain alphabet by specifying the charnames pragma:

           use charnames qw(greek);
           print "\N{sigma} is Greek sigma\n";

       An    index    of    character    names    is    available   on-line   from   the   Unicode   Consortium,
       <https://www.unicode.org/charts/charindex.html>; explanatory material with links to  other  resources  at
       <https://www.unicode.org/standard/where>.

       Starting in Perl v5.32, an alternative to "\N{...}" for full names is available, and that is to say

        /\p{Name=greek small letter sigma}/

       The  casing  of the character name is irrelevant when used in "\p{}", as are most spaces, underscores and
       hyphens.  (A few outlier characters cause problems with ignoring all of them always.  The details  (which
       you    can    look    up    when    you   get   more   proficient,   and   if   ever   needed)   are   in
       <https://www.unicode.org/reports/tr44/tr44-24.html#UAX44-LM2>).

       The answer to requirement 2) is that a regexp (mostly) uses Unicode  characters.   The  "mostly"  is  for
       messy  backward  compatibility  reasons, but starting in Perl 5.14, any regexp compiled in the scope of a
       "use feature 'unicode_strings'" (which is automatically turned on within the scope of a  "use  v5.12"  or
       higher) will turn that "mostly" into "always".  If you want to handle Unicode properly, you should ensure
       that 'unicode_strings' is turned on.  Internally, this is encoded to bytes using either UTF-8 or a native
       8  bit encoding, depending on the history of the string, but conceptually it is a sequence of characters,
       not bytes. See perlunitut for a tutorial about that.

       Let us now discuss Unicode character classes, most usually  called  "character  properties".   These  are
       represented  by  the  "\p{name}"  escape  sequence.  The negation of this is "\P{name}".  For example, to
       match lower and uppercase characters,

           $x = "BOB";
           $x =~ /^\p{IsUpper}/;   # matches, uppercase char class
           $x =~ /^\P{IsUpper}/;   # doesn't match, char class sans uppercase
           $x =~ /^\p{IsLower}/;   # doesn't match, lowercase char class
           $x =~ /^\P{IsLower}/;   # matches, char class sans lowercase

       (The ""Is"" is optional.)

       There are many, many Unicode character properties.  For the full list see  perluniprops.   Most  of  them
       have  synonyms  with shorter names, also listed there.  Some synonyms are a single character.  For these,
       you can drop the braces.  For instance, "\pM" is the same thing as "\p{Mark}", meaning things like accent
       marks.

       The Unicode "\p{Script}" and "\p{Script_Extensions}" properties are  used  to  categorize  every  Unicode
       character  into the language script it is written in.  For example, English, French, and a bunch of other
       European languages are written in the Latin script.  But there is also the Greek script, the Thai script,
       the Katakana script, etc.  ("Script" is an older, less advanced, form  of  "Script_Extensions",  retained
       only for backwards compatibility.)  You can test whether a character is in a particular script  with, for
       example  "\p{Latin}",  "\p{Greek}",  or  "\p{Katakana}".  To test if it isn't in the Balinese script, you
       would use "\P{Balinese}".  (These all use "Script_Extensions"  under  the  hood,  as  that  gives  better
       results.)

       What  we  have  described  so far is the single form of the "\p{...}" character classes.  There is also a
       compound form which you may run into.  These look like "\p{name=value}" or "\p{name:value}"  (the  equals
       sign  and  colon  can be used interchangeably).  These are more general than the single form, and in fact
       most of the single forms are just Perl-defined shortcuts for common compound  forms.   For  example,  the
       script examples in the previous paragraph could be written equivalently as "\p{Script_Extensions=Latin}",
       "\p{Script_Extensions:Greek}",   "\p{script_extensions=katakana}",  and  "\P{script_extensions=balinese}"
       (case is irrelevant between the "{}" braces).  You  may  never  have  to  use  the  compound  forms,  but
       sometimes it is necessary, and their use can make your code easier to understand.

       "\X"  is  an abbreviation for a character class that comprises a Unicode extendedgraphemecluster.  This
       represents a "logical character": what  appears  to  be  a  single  character,  but  may  be  represented
       internally  by more than one.  As an example, using the Unicode full names, e.g., "A + COMBINING RING" is
       a grapheme cluster with base character "A" and combining character "COMBINING RING, which  translates  in
       Danish to "A" with the circle atop it, as in the word Ångstrom.

       For  the  full  and  latest  information  about  Unicode  see the latest Unicode standard, or the Unicode
       Consortium's website <https://www.unicode.org>

       As if all those classes weren't enough, Perl also defines POSIX-style character classes.  These have  the
       form "[:name:]", with name the name of the POSIX class.  The POSIX classes are "alpha", "alnum", "ascii",
       "blank",  "cntrl", "digit", "graph", "lower", "print", "punct", "space", "upper", "xdigit", and "word" (a
       Perl extension to match "\w").  The "/a" modifier restricts these to matching just in  the  ASCII  range;
       otherwise they can match the same as their corresponding Perl Unicode classes: "[:upper:]" is the same as
       "\p{IsUpper}",  etc.   (There  are  some exceptions and gotchas with this; see perlrecharclass for a full
       discussion.) The "[:digit:]", "[:word:]", and "[:space:]" correspond to the familiar "\d", "\w", and "\s"
       character classes.  To negate a POSIX class, put a '^' in front of the name, so that, e.g.,  "[:^digit:]"
       corresponds  to  "\D"  and, under Unicode, "\P{IsDigit}".  The Unicode and POSIX character classes can be
       used just like "\d", with the exception that POSIX character  classes  can  only  be  used  inside  of  a
       character class:

           /\s+[abc[:digit:]xyz]\s*/;  # match a,b,c,x,y,z, or a digit
           /^=item\s[[:digit:]]/;      # match '=item',
                                       # followed by a space and a digit
           /\s+[abc\p{IsDigit}xyz]\s+/;  # match a,b,c,x,y,z, or a digit
           /^=item\s\p{IsDigit}/;        # match '=item',
                                         # followed by a space and a digit

       Whew! That is all the rest of the characters and character classes.

   Compilingandsavingregularexpressions
       In  Part 1 we mentioned that Perl compiles a regexp into a compact sequence of opcodes.  Thus, a compiled
       regexp is a data structure that can be stored once and used again and again.   The  regexp  quote  "qr//"
       does  exactly  that: "qr/string/" compiles the "string" as a regexp and transforms the result into a form
       that can be assigned to a variable:

           $reg = qr/foo+bar?/;  # reg contains a compiled regexp

       Then $reg can be used as a regexp:

           $x = "fooooba";
           $x =~ $reg;     # matches, just like /foo+bar?/
           $x =~ /$reg/;   # same thing, alternate form

       $reg can also be interpolated into a larger regexp:

           $x =~ /(abc)?$reg/;  # still matches

       As with the matching operator, the regexp quote can use different delimiters,  e.g.,  "qr!!",  "qr{}"  or
       "qr~~".  Apostrophes as delimiters ("qr''") inhibit any interpolation.

       Pre-compiled  regexps  are useful for creating dynamic matches that don't need to be recompiled each time
       they are encountered.  Using pre-compiled regexps, we write a  "grep_step"  program  which  greps  for  a
       sequence of patterns, advancing to the next pattern as soon as one has been satisfied.

           % cat > grep_step
           #!/usr/bin/perl
           # grep_step - match <number> regexps, one after the other
           # usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...

           $number = shift;
           $regexp[$_] = shift foreach (0..$number-1);
           @compiled = map qr/$_/, @regexp;
           while ($line = <>) {
               if ($line =~ /$compiled[0]/) {
                   print $line;
                   shift @compiled;
                   last unless @compiled;
               }
           }
           ^D

           % grep_step 3 shift print last grep_step
           $number = shift;
                   print $line;
                   last unless @compiled;

       Storing  pre-compiled  regexps in an array @compiled allows us to simply loop through the regexps without
       any recompilation, thus gaining flexibility without sacrificing speed.

   Composingregularexpressionsatruntime
       Backtracking is more efficient than repeated tries with different  regular  expressions.   If  there  are
       several  regular  expressions  and a match with any of them is acceptable, then it is possible to combine
       them into a set of alternatives.  If the individual expressions are input  data,  this  can  be  done  by
       programming  a  join  operation.   We'll  exploit  this  idea in an improved version of the "simple_grep"
       program: a program that matches multiple patterns:

           % cat > multi_grep
           #!/usr/bin/perl
           # multi_grep - match any of <number> regexps
           # usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...

           $number = shift;
           $regexp[$_] = shift foreach (0..$number-1);
           $pattern = join '|', @regexp;

           while ($line = <>) {
               print $line if $line =~ /$pattern/;
           }
           ^D

           % multi_grep 2 shift for multi_grep
           $number = shift;
           $regexp[$_] = shift foreach (0..$number-1);

       Sometimes it is advantageous to construct a pattern from the input that is to be  analyzed  and  use  the
       permissible  values  on  the  left hand side of the matching operations.  As an example for this somewhat
       paradoxical situation, let's assume that our input contains a command verb which should match one out  of
       a  set  of available command verbs, with the additional twist that commands may be abbreviated as long as
       the given string is unique. The program below demonstrates the basic algorithm.

           % cat > keymatch
           #!/usr/bin/perl
           $kwds = 'copy compare list print';
           while( $cmd = <> ){
               $cmd =~ s/^\s+|\s+$//g;  # trim leading and trailing spaces
               if( ( @matches = $kwds =~ /\b$cmd\w*/g ) == 1 ){
                   print "command: '@matches'\n";
               } elsif( @matches == 0 ){
                   print "no such command: '$cmd'\n";
               } else {
                   print "not unique: '$cmd' (could be one of: @matches)\n";
               }
           }
           ^D

           % keymatch
           li
           command: 'list'
           co
           not unique: 'co' (could be one of: copy compare)
           printer
           no such command: 'printer'

       Rather than trying to match the input against the keywords, we match the combined set of keywords against
       the input.  The pattern matching operation "$kwds =~ /\b($cmd\w*)/g" does  several  things  at  the  same
       time.  It  makes  sure  that  the  given  command  begins  where  a  keyword  begins ("\b"). It tolerates
       abbreviations due to the added "\w*". It tells us the number of matches ("scalar @matches") and  all  the
       keywords that were actually matched.  You could hardly ask for more.

   Embeddingcommentsandmodifiersinaregularexpression
       Starting  with this section, we will be discussing Perl's set of extendedpatterns.  These are extensions
       to the traditional regular expression syntax that provide powerful new tools for  pattern  matching.   We
       have  already  seen extensions in the form of the minimal matching constructs "??", "*?", "+?", "{n,m}?",
       "{n,}?", and "{,n}?".  Most of the extensions below have the form "(?char...)", where  the  "char"  is  a
       character that determines the type of extension.

       The first extension is an embedded comment "(?#text)".  This embeds a comment into the regular expression
       without  affecting  its  meaning.   The  comment should not have any closing parentheses in the text.  An
       example is

           /(?# Match an integer:)[+-]?\d+/;

       This style of commenting has been largely superseded by the raw, freeform commenting that is allowed with
       the "/x" modifier.

       Most modifiers, such as "/i", "/m", "/s" and "/x" (or any combination thereof) can also be embedded in  a
       regexp using "(?i)", "(?m)", "(?s)", and "(?x)".  For instance,

           /(?i)yes/;  # match 'yes' case insensitively
           /yes/i;     # same thing
           /(?x)(          # freeform version of an integer regexp
                    [+-]?  # match an optional sign
                    \d+    # match a sequence of digits
                )
           /x;

       Embedded  modifiers can have two important advantages over the usual modifiers.  Embedded modifiers allow
       a custom set of modifiers for each regexp pattern.  This is great for matching an array of  regexps  that
       must have different modifiers:

           $pattern[0] = '(?i)doctor';
           $pattern[1] = 'Johnson';
           ...
           while (<>) {
               foreach $patt (@pattern) {
                   print if /$patt/;
               }
           }

       The  second  advantage  is  that  embedded modifiers (except "/p", which modifies the entire regexp) only
       affect the regexp inside the group the embedded modifier is contained in.  So grouping  can  be  used  to
       localize the modifier's effects:

           /Answer: ((?i)yes)/;  # matches 'Answer: yes', 'Answer: YES', etc.

       Embedded  modifiers  can  also turn off any modifiers already present by using, e.g., "(?-i)".  Modifiers
       can also be combined into a single expression, e.g., "(?s-i)" turns on single line  mode  and  turns  off
       case insensitivity.

       Embedded  modifiers  may  also  be added to a non-capturing grouping.  "(?i-m:regexp)" is a non-capturing
       grouping that matches "regexp" case insensitively and turns off multi-line mode.

   Lookingaheadandlookingbehind
       This section concerns the lookahead and lookbehind assertions.  First, a little background.

       In Perl regular expressions, most regexp elements "eat up" a certain amount of string  when  they  match.
       For  instance,  the  regexp  element  "[abc]" eats up one character of the string when it matches, in the
       sense that Perl moves to the next character position in the string  after  the  match.   There  are  some
       elements,  however,  that  don't  eat  up characters (advance the character position) if they match.  The
       examples we have seen so far are the anchors.  The anchor '^' matches the  beginning  of  the  line,  but
       doesn't  eat  any  characters.   Similarly,  the  word  boundary anchor "\b" matches wherever a character
       matching "\w" is next to a character that doesn't, but it doesn't eat up any characters itself.   Anchors
       are  examples  of  zero-widthassertions: zero-width, because they consume no characters, and assertions,
       because they test some property of the string.  In the context of our walk in the woods analogy to regexp
       matching, most regexp elements move us along a trail, but anchors have us stop a  moment  and  check  our
       surroundings.  If the local environment checks out, we can proceed forward.  But if the local environment
       doesn't satisfy us, we must backtrack.

       Checking  the  environment entails either looking ahead on the trail, looking behind, or both.  '^' looks
       behind, to see that there are no characters before.  '$' looks ahead, to see that there are no characters
       after.  "\b" looks both ahead and behind, to see if the characters on either side differ in their  "word-
       ness".

       The  lookahead  and  lookbehind  assertions  are  generalizations  of  the anchor concept.  Lookahead and
       lookbehind are zero-width assertions that let us specify which characters  we  want  to  test  for.   The
       lookahead   assertion  is  denoted  by  "(?=regexp)"  or  (starting  in  5.32,  experimentally  in  5.28)
       "(*pla:regexp)"  or  "(*positive_lookahead:regexp)";  and  the  lookbehind  assertion   is   denoted   by
       "(?<=fixed-regexp)"   or   (starting   in   5.32,   experimentally   in  5.28)  "(*plb:fixed-regexp)"  or
       "(*positive_lookbehind:fixed-regexp)".  Some examples are

           $x = "I catch the housecat 'Tom-cat' with catnip";
           $x =~ /cat(*pla:\s)/;   # matches 'cat' in 'housecat'
           @catwords = ($x =~ /(?<=\s)cat\w+/g);  # matches,
                                                  # $catwords[0] = 'catch'
                                                  # $catwords[1] = 'catnip'
           $x =~ /\bcat\b/;  # matches 'cat' in 'Tom-cat'
           $x =~ /(?<=\s)cat(?=\s)/; # doesn't match; no isolated 'cat' in
                                     # middle of $x

       Note that the parentheses in these are non-capturing, since these are zero-width assertions.  Thus in the
       second regexp, the substrings captured are those  of  the  whole  regexp  itself.   Lookahead  can  match
       arbitrary  regexps,  but  lookbehind  prior  to  5.30 "(?<=fixed-regexp)" only works for regexps of fixed
       width, i.e., a fixed number of characters long.  Thus "(?<=(ab|bc))" is fine, but "(?<=(ab)*)"  prior  to
       5.30 is not.

       The  negated  versions  of  the  lookahead  and  lookbehind  assertions  are  denoted by "(?!regexp)" and
       "(?<!fixed-regexp)" respectively.  Or,  starting  in  5.32  (experimentally  in  5.28),  "(*nla:regexp)",
       "(*negative_lookahead:regexp)",  "(*nlb:regexp)", or "(*negative_lookbehind:regexp)".  They evaluate true
       if the regexps do not match:

           $x = "foobar";
           $x =~ /foo(?!bar)/;  # doesn't match, 'bar' follows 'foo'
           $x =~ /foo(?!baz)/;  # matches, 'baz' doesn't follow 'foo'
           $x =~ /(?<!\s)foo/;  # matches, there is no \s before 'foo'

       Here is an example where a string containing blank-separated words, numbers and single dashes  is  to  be
       split  into  its  components.   Using  "/\s+/"  alone won't work, because spaces are not required between
       dashes, or a word or a dash. Additional places for a split are established by looking ahead and behind:

           $str = "one two - --6-8";
           @toks = split / \s+              # a run of spaces
                         | (?<=\S) (?=-)    # any non-space followed by '-'
                         | (?<=-)  (?=\S)   # a '-' followed by any non-space
                         /x, $str;          # @toks = qw(one two - - - 6 - 8)

   UsingindependentsubexpressionstopreventbacktrackingIndependentsubexpressions (or atomic subexpressions) are regular expressions, in the context of a larger
       regular expression, that function independently of the larger regular expression.  That is, they  consume
       as  much  or  as little of the string as they wish without regard for the ability of the larger regexp to
       match.  Independent subexpressions are represented by "(?>regexp)" or (starting in  5.32,  experimentally
       in 5.28) "(*atomic:regexp)".  We can illustrate their behavior by first considering an ordinary regexp:

           $x = "ab";
           $x =~ /a*ab/;  # matches

       This  obviously  matches,  but  in the process of matching, the subexpression "a*" first grabbed the 'a'.
       Doing so, however, wouldn't allow the whole regexp to match, so after backtracking, "a*" eventually  gave
       back the 'a' and matched the empty string.  Here, what "a*" matched was dependent on what the rest of the
       regexp matched.

       Contrast that with an independent subexpression:

           $x =~ /(?>a*)ab/;  # doesn't match!

       The  independent  subexpression "(?>a*)" doesn't care about the rest of the regexp, so it sees an 'a' and
       grabs it.  Then the rest of the regexp "ab" cannot match.  Because "(?>a*)" is independent, there  is  no
       backtracking and the independent subexpression does not give up its 'a'.  Thus the match of the regexp as
       a whole fails.  A similar behavior occurs with completely independent regexps:

           $x = "ab";
           $x =~ /a*/g;   # matches, eats an 'a'
           $x =~ /\Gab/g; # doesn't match, no 'a' available

       Here  "/g" and "\G" create a "tag team" handoff of the string from one regexp to the other.  Regexps with
       an independent subexpression are much like this,  with  a  handoff  of  the  string  to  the  independent
       subexpression, and a handoff of the string back to the enclosing regexp.

       The ability of an independent subexpression to prevent backtracking can be quite useful.  Suppose we want
       to  match  a  non-empty  string enclosed in parentheses up to two levels deep.  Then the following regexp
       matches:

           $x = "abc(de(fg)h";  # unbalanced parentheses
           $x =~ /\( ( [ ^ () ]+ | \( [ ^ () ]* \) )+ \)/xx;

       The regexp matches an open parenthesis, one or more copies of an alternation, and  a  close  parenthesis.
       The  alternation is two-way, with the first alternative "[^()]+" matching a substring with no parentheses
       and the second alternative "\([^()]*\)"  matching a substring delimited by parentheses.  The problem with
       this regexp is that it is pathological: it has nested indeterminate quantifiers of  the  form  "(a+|b)+".
       We  discussed in Part 1 how nested quantifiers like this could take an exponentially long time to execute
       if there is no  match  possible.   To  prevent  the  exponential  blowup,  we  need  to  prevent  useless
       backtracking  at  some  point.   This  can  be  done  by enclosing the inner quantifier as an independent
       subexpression:

           $x =~ /\( ( (?> [ ^ () ]+ ) | \([ ^ () ]* \) )+ \)/xx;

       Here, "(?>[^()]+)" breaks the degeneracy of string partitioning by gobbling up as much of the  string  as
       possible and keeping it.   Then match failures fail much more quickly.

   Conditionalexpressions
       A conditionalexpression is a form of if-then-else statement that allows one to choose which patterns are
       to   be   matched,   based   on   some  condition.   There  are  two  types  of  conditional  expression:
       "(?(condition)yes-regexp)" and "(?(condition)yes-regexp|no-regexp)".  "(?(condition)yes-regexp)" is  like
       an  'if () {}'  statement  in  Perl.   If  the condition is true, the yes-regexp will be matched.  If the
       condition is false, the yes-regexp will be skipped and Perl will move onto the next regexp element.   The
       second  form  is  like an 'if () {} else {}' statement in Perl.  If the condition is true, the yes-regexp
       will be matched, otherwise the no-regexp will be matched.

       The condition can have several forms.  The first form is simply an integer  in  parentheses  "(integer)".
       It  is  true if the corresponding backreference "\integer" matched earlier in the regexp.  The same thing
       can be done with a name associated with a capture group, written as "(<name>)" or "('name')".  The second
       form is a bare zero-width assertion "(?...)", either a lookahead,  a  lookbehind,  or  a  code  assertion
       (discussed  in  the  next  section).   The  third  set  of  forms  provides tests that return true if the
       expression is executed within a  recursion  ("(R)")  or  is  being  called  from  some  capturing  group,
       referenced either by number ("(R1)", "(R2)",...) or by name ("(R&name)").

       The  integer  or  name  form of the "condition" allows us to choose, with more flexibility, what to match
       based on what matched earlier in the regexp. This searches for words of the form "$x$x" or "$x$y$y$x":

           % simple_grep '^(\w+)(\w+)?(?(2)\g2\g1|\g1)$' /usr/dict/words
           beriberi
           coco
           couscous
           deed
           ...
           toot
           toto
           tutu

       The lookbehind "condition" allows, along with backreferences, an earlier part of the match to influence a
       later part of the match.  For instance,

           /[ATGC]+(?(?<=AA)G|C)$/;

       matches a DNA sequence such that it either ends in "AAG", or some other base pair  combination  and  'C'.
       Note  that  the  form is "(?(?<=AA)G|C)" and not "(?((?<=AA))G|C)"; for the lookahead, lookbehind or code
       assertions, the parentheses around the conditional are not needed.

   Definingnamedpatterns
       Some regular expressions use identical subpatterns in several places.  Starting with  Perl  5.10,  it  is
       possible  to  define  named subpatterns in a section of the pattern so that they can be called up by name
       anywhere   in   the   pattern.    This   syntactic    pattern    for    this    definition    group    is
       "(?(DEFINE)(?<name>pattern)...)".  An insertion of a named pattern is written as "(?&name)".

       The  example  below  illustrates  this  feature  using  the  pattern  for floating point numbers that was
       presented earlier on.  The three subpatterns that are used more than once  are  the  optional  sign,  the
       digit  sequence  for  an  integer and the decimal fraction.  The "DEFINE" group at the end of the pattern
       contains their definition.  Notice that the decimal fraction pattern is the  first  place  where  we  can
       reuse the integer pattern.

          /^ (?&osg)\ * ( (?&int)(?&dec)? | (?&dec) )
             (?: [eE](?&osg)(?&int) )?
           $
           (?(DEFINE)
             (?<osg>[-+]?)         # optional sign
             (?<int>\d++)          # integer
             (?<dec>\.(?&int))     # decimal fraction
           )/x

   Recursivepatterns
       This  feature  (introduced  in Perl 5.10) significantly extends the power of Perl's pattern matching.  By
       referring to some other capture group anywhere in the pattern  with  the  construct  "(?group-ref)",  the
       pattern  within the referenced group is used as an independent subpattern in place of the group reference
       itself.  Because the group reference may be contained within the group it refers to, it is  now  possible
       to apply pattern matching to tasks that hitherto required a recursive parser.

       To  illustrate this feature, we'll design a pattern that matches if a string contains a palindrome. (This
       is a word or a sentence that, while ignoring spaces, interpunctuation and case, reads the same  backwards
       as  forwards.  We begin by observing that the empty string or a string containing just one word character
       is a palindrome. Otherwise it must have a word character up front and the same at its end,  with  another
       palindrome in between.

        /(?: (\w) (?...Here be a palindrome...) \g{ -1 } | \w? )/x

       Adding "\W*" at either end to eliminate what is to be ignored, we already have the full pattern:

           my $pp = qr/^(\W* (?: (\w) (?1) \g{-1} | \w? ) \W*)$/ix;
           for $s ( "saippuakauppias", "A man, a plan, a canal: Panama!" ){
               print "'$s' is a palindrome\n" if $s =~ /$pp/;
           }

       In  "(?...)" both absolute and relative backreferences may be used.  The entire pattern can be reinserted
       with "(?R)" or "(?0)".  If you prefer to name your groups, you can use "(?&name)" to  recurse  into  that
       group.

   Abitofmagic:executingPerlcodeinaregularexpression
       Normally,  regexps  are  a  part  of  Perl  expressions.  Codeevaluation expressions turn that around by
       allowing arbitrary Perl code to be a  part  of  a  regexp.   A  code  evaluation  expression  is  denoted
       "(?{code})", with code a string of Perl statements.

       Code  expressions  are  zero-width  assertions,  and  the value they return depends on their environment.
       There are two possibilities: either the code expression  is  used  as  a  conditional  in  a  conditional
       expression  "(?(condition)...)",  or  it  is  not.   If the code expression is a conditional, the code is
       evaluated and the result (i.e., the result  of  the  last  statement)  is  used  to  determine  truth  or
       falsehood.   If the code expression is not used as a conditional, the assertion always evaluates true and
       the result is put into the special variable $^R.  The variable $^R can then be used in  code  expressions
       later in the regexp.  Here are some silly examples:

           $x = "abcdef";
           $x =~ /abc(?{print "Hi Mom!";})def/; # matches,
                                                # prints 'Hi Mom!'
           $x =~ /aaa(?{print "Hi Mom!";})def/; # doesn't match,
                                                # no 'Hi Mom!'

       Pay careful attention to the next example:

           $x =~ /abc(?{print "Hi Mom!";})ddd/; # doesn't match,
                                                # no 'Hi Mom!'
                                                # but why not?

       At  first  glance,  you'd think that it shouldn't print, because obviously the "ddd" isn't going to match
       the target string. But look at this example:

           $x =~ /abc(?{print "Hi Mom!";})[dD]dd/; # doesn't match,
                                                   # but _does_ print

       Hmm. What happened here? If you've been following along, you  know  that  the  above  pattern  should  be
       effectively  (almost)  the  same  as  the last one; enclosing the 'd' in a character class isn't going to
       change what it matches. So why does the first not print while the second one does?

       The answer lies in the optimizations the regexp engine makes. In the first case, all the engine sees  are
       plain old characters (aside from the "?{}" construct). It's smart enough to realize that the string 'ddd'
       doesn't  occur  in our target string before actually running the pattern through. But in the second case,
       we've tricked it into thinking that our pattern is more complicated. It takes a look, sees our  character
       class,  and decides that it will have to actually run the pattern to determine whether or not it matches,
       and in the process of running it hits the print statement before it discovers that we don't have a match.

       To take a closer look at how the engine does optimizations,  see  the  section  "Pragmas  and  debugging"
       below.

       More fun with "?{}":

           $x =~ /(?{print "Hi Mom!";})/;         # matches,
                                                  # prints 'Hi Mom!'
           $x =~ /(?{$c = 1;})(?{print "$c";})/;  # matches,
                                                  # prints '1'
           $x =~ /(?{$c = 1;})(?{print "$^R";})/; # matches,
                                                  # prints '1'

       The  bit  of  magic  mentioned  in  the section title occurs when the regexp backtracks in the process of
       searching for a match.  If the regexp backtracks over a code expression and if the variables used  within
       are  localized  using  "local",  the changes in the variables produced by the code expression are undone!
       Thus, if we wanted to count how many times a character got matched inside a group, we could use, e.g.,

           $x = "aaaa";
           $count = 0;  # initialize 'a' count
           $c = "bob";  # test if $c gets clobbered
           $x =~ /(?{local $c = 0;})         # initialize count
                  ( a                        # match 'a'
                    (?{local $c = $c + 1;})  # increment count
                  )*                         # do this any number of times,
                  aa                         # but match 'aa' at the end
                  (?{$count = $c;})          # copy local $c var into $count
                 /x;
           print "'a' count is $count, \$c variable is '$c'\n";

       This prints

           'a' count is 2, $c variable is 'bob'

       If we replace the " (?{local $c = $c + 1;})" with " (?{$c = $c + 1;})",  the  variable  changes  are  not
       undone during backtracking, and we get

           'a' count is 4, $c variable is 'bob'

       Note  that  only  localized variable changes are undone.  Other side effects of code expression execution
       are permanent.  Thus

           $x = "aaaa";
           $x =~ /(a(?{print "Yow\n";}))*aa/;

       produces

          Yow
          Yow
          Yow
          Yow

       The result $^R is  automatically  localized,  so  that  it  will  behave  properly  in  the  presence  of
       backtracking.

       This example uses a code expression in a conditional to match a definite article, either 'the' in English
       or 'der|die|das' in German:

           $lang = 'DE';  # use German
           ...
           $text = "das";
           print "matched\n"
               if $text =~ /(?(?{
                                 $lang eq 'EN'; # is the language English?
                                })
                              the |             # if so, then match 'the'
                              (der|die|das)     # else, match 'der|die|das'
                            )
                           /xi;

       Note  that the syntax here is "(?(?{...})yes-regexp|no-regexp)", not "(?((?{...}))yes-regexp|no-regexp)".
       In other words, in the case of a code  expression,  we  don't  need  the  extra  parentheses  around  the
       conditional.

       If  you  try  to  use  code expressions where the code text is contained within an interpolated variable,
       rather than appearing literally in the pattern, Perl may surprise you:

           $bar = 5;
           $pat = '(?{ 1 })';
           /foo(?{ $bar })bar/; # compiles ok, $bar not interpolated
           /foo(?{ 1 })$bar/;   # compiles ok, $bar interpolated
           /foo${pat}bar/;      # compile error!

           $pat = qr/(?{ $foo = 1 })/;  # precompile code regexp
           /foo${pat}bar/;      # compiles ok

       If a regexp has a variable that interpolates a code expression, Perl treats the regexp as  an  error.  If
       the code expression is precompiled into a variable, however, interpolating is ok. The question is, why is
       this an error?

       The  reason  is  that  variable  interpolation  and  code expressions together pose a security risk.  The
       combination is dangerous because many programmers who write search engines often take user input and plug
       it directly into a regexp:

           $regexp = <>;       # read user-supplied regexp
           $chomp $regexp;     # get rid of possible newline
           $text =~ /$regexp/; # search $text for the $regexp

       If the $regexp variable contains a code expression, the user could then execute arbitrary Perl code.  For
       instance, some joker could search for "system('rm -rf *');" to erase your  files.   In  this  sense,  the
       combination  of  interpolation  and  code  expressions  taints  your  regexp.   So by default, using both
       interpolation and code expressions in the same regexp is not allowed.   If  you're  not  concerned  about
       malicious users, it is possible to bypass this security check by invoking "use re 'eval'":

           use re 'eval';       # throw caution out the door
           $bar = 5;
           $pat = '(?{ 1 })';
           /foo${pat}bar/;      # compiles ok

       Another  form  of  code expression is the patterncodeexpression.  The pattern code expression is like a
       regular code expression, except that the result of the code evaluation is treated as a regular expression
       and matched immediately.  A simple example is

           $length = 5;
           $char = 'a';
           $x = 'aaaaabb';
           $x =~ /(??{$char x $length})/x; # matches, there are 5 of 'a'

       This final example contains both ordinary and pattern code expressions.   It  detects  whether  a  binary
       string 1101010010001... has a Fibonacci spacing 0,1,1,2,3,5,...  of the '1''s:

           $x = "1101010010001000001";
           $z0 = ''; $z1 = '0';   # initial conditions
           print "It is a Fibonacci sequence\n"
               if $x =~ /^1         # match an initial '1'
                           (?:
                              ((??{ $z0 })) # match some '0'
                              1             # and then a '1'
                              (?{ $z0 = $z1; $z1 .= $^N; })
                           )+   # repeat as needed
                         $      # that is all there is
                        /x;
           printf "Largest sequence matched was %d\n", length($z1)-length($z0);

       Remember that $^N is set to whatever was matched by the last completed capture group. This prints

           It is a Fibonacci sequence
           Largest sequence matched was 5

       Ha! Try that with your garden variety regexp package...

       Note  that  the  variables  $z0  and  $z1 are not substituted when the regexp is compiled, as happens for
       ordinary variables outside a code expression.  Rather, the whole code block is parsed as perl code at the
       same time as perl is compiling the code containing the literal regexp pattern.

       This regexp without the "/x" modifier is

           /^1(?:((??{ $z0 }))1(?{ $z0 = $z1; $z1 .= $^N; }))+$/

       which shows that spaces are still possible in the code parts. Nevertheless, when working  with  code  and
       conditional  expressions,  the  extended  form  of  regexps is almost necessary in creating and debugging
       regexps.

   Backtrackingcontrolverbs
       Perl 5.10 introduced a number of control verbs intended to provide detailed control over the backtracking
       process, by directly influencing the regexp engine and by providing monitoring techniques.  See  "Special
       Backtracking Control Verbs" in perlre for a detailed description.

       Below  is  just one example, illustrating the control verb "(*FAIL)", which may be abbreviated as "(*F)".
       If this is inserted in a regexp it will cause it to fail, just as it would at some mismatch  between  the
       pattern  and  the  string.  Processing of the regexp continues as it would after any "normal" failure, so
       that, for instance, the next position in the string or another alternative will be tried. As  failing  to
       match  doesn't preserve capture groups or produce results, it may be necessary to use this in combination
       with embedded code.

          %count = ();
          "supercalifragilisticexpialidocious" =~
              /([aeiou])(?{ $count{$1}++; })(*FAIL)/i;
          printf "%3d '%s'\n", $count{$_}, $_ for (sort keys %count);

       The pattern begins with a class matching a subset of letters.  Whenever this matches,  a  statement  like
       "$count{'a'}++;"  is  executed,  incrementing the letter's counter. Then "(*FAIL)" does what it says, and
       the regexp engine proceeds according to the book: as long as the end of the string hasn't  been  reached,
       the  position  is advanced before looking for another vowel. Thus, match or no match makes no difference,
       and the regexp engine proceeds until the entire string has been  inspected.   (It's  remarkable  that  an
       alternative solution using something like

          $count{lc($_)}++ for split('', "supercalifragilisticexpialidocious");
          printf "%3d '%s'\n", $count2{$_}, $_ for ( qw{ a e i o u } );

       is considerably slower.)

   Pragmasanddebugging
       Speaking of debugging, there are several pragmas available to control and debug regexps in Perl.  We have
       already  encountered  one  pragma  in  the  previous  section,  "use re 'eval';",  that  allows  variable
       interpolation and code expressions to coexist in a regexp.  The other pragmas are

           use re 'taint';
           $tainted = <>;
           @parts = ($tainted =~ /(\w+)\s+(\w+)/; # @parts is now tainted

       The "taint" pragma causes any substrings from a match with a tainted variable to be tainted as  well,  if
       your  perl  supports tainting (see perlsec).  This is not normally the case, as regexps are often used to
       extract the safe bits from a tainted variable.  Use "taint" when you are not extracting  safe  bits,  but
       are  performing some other processing.  Both "taint" and "eval" pragmas are lexically scoped, which means
       they are in effect only until the end of the block enclosing the pragmas.

           use re '/m';  # or any other flags
           $multiline_string =~ /^foo/; # /m is implied

       The "re '/flags'" pragma (introduced in Perl 5.14) turns on the given regular expression flags until  the
       end of the lexical scope.  See "'/flags' mode" in re for more detail.

           use re 'debug';
           /^(.*)$/s;       # output debugging info

           use re 'debugcolor';
           /^(.*)$/s;       # output debugging info in living color

       The  global  "debug"  and  "debugcolor"  pragmas  allow  one  to get detailed debugging info about regexp
       compilation and execution.  "debugcolor" is the same  as  debug,  except  the  debugging  information  is
       displayed in color on terminals that can display termcap color sequences.  Here is example output:

           % perl -e 'use re "debug"; "abc" =~ /a*b+c/;'
           Compiling REx 'a*b+c'
           size 9 first at 1
              1: STAR(4)
              2:   EXACT <a>(0)
              4: PLUS(7)
              5:   EXACT <b>(0)
              7: EXACT <c>(9)
              9: END(0)
           floating 'bc' at 0..2147483647 (checking floating) minlen 2
           Guessing start of match, REx 'a*b+c' against 'abc'...
           Found floating substr 'bc' at offset 1...
           Guessed: match at offset 0
           Matching REx 'a*b+c' against 'abc'
             Setting an EVAL scope, savestack=3
              0 <> <abc>           |  1:  STAR
                                    EXACT <a> can match 1 times out of 32767...
             Setting an EVAL scope, savestack=3
              1 <a> <bc>           |  4:    PLUS
                                    EXACT <b> can match 1 times out of 32767...
             Setting an EVAL scope, savestack=3
              2 <ab> <c>           |  7:      EXACT <c>
              3 <abc> <>           |  9:      END
           Match successful!
           Freeing REx: 'a*b+c'

       If  you  have  gotten  this far into the tutorial, you can probably guess what the different parts of the
       debugging output tell you.  The first part

           Compiling REx 'a*b+c'
           size 9 first at 1
              1: STAR(4)
              2:   EXACT <a>(0)
              4: PLUS(7)
              5:   EXACT <b>(0)
              7: EXACT <c>(9)
              9: END(0)

       describes the compilation stage.  STAR(4) means that there is a starred object, in this case 'a', and  if
       it  matches,  goto  line  4,  i.e., PLUS(7).  The middle lines describe some heuristics and optimizations
       performed before a match:

           floating 'bc' at 0..2147483647 (checking floating) minlen 2
           Guessing start of match, REx 'a*b+c' against 'abc'...
           Found floating substr 'bc' at offset 1...
           Guessed: match at offset 0

       Then the match is executed and the remaining lines describe the process:

           Matching REx 'a*b+c' against 'abc'
             Setting an EVAL scope, savestack=3
              0 <> <abc>           |  1:  STAR
                                    EXACT <a> can match 1 times out of 32767...
             Setting an EVAL scope, savestack=3
              1 <a> <bc>           |  4:    PLUS
                                    EXACT <b> can match 1 times out of 32767...
             Setting an EVAL scope, savestack=3
              2 <ab> <c>           |  7:      EXACT <c>
              3 <abc> <>           |  9:      END
           Match successful!
           Freeing REx: 'a*b+c'

       Each step is of the form "n <x> <y>", with "<x>" the part of the string matched and "<y>"  the  part  not
       yet  matched.   The  "|  1:  STAR" says that Perl is at line number 1 in the compilation list above.  See
       "Debugging Regular Expressions" in perldebguts for much more detail.

       An alternative method of debugging regexps is to  embed  "print"  statements  within  the  regexp.   This
       provides a blow-by-blow account of the backtracking in an alternation:

           "that this" =~ m@(?{print "Start at position ", pos, "\n";})
                            t(?{print "t1\n";})
                            h(?{print "h1\n";})
                            i(?{print "i1\n";})
                            s(?{print "s1\n";})
                                |
                            t(?{print "t2\n";})
                            h(?{print "h2\n";})
                            a(?{print "a2\n";})
                            t(?{print "t2\n";})
                            (?{print "Done at position ", pos, "\n";})
                           @x;

       prints

           Start at position 0
           t1
           h1
           t2
           h2
           a2
           t2
           Done at position 4

See Also

       This  is  just  a  tutorial.   For  the  full  story  on Perl regular expressions, see the perlre regular
       expressions reference page.

       For more information on the matching "m//" and substitution  "s///"  operators,  see  "Regexp  Quote-Like
       Operators" in perlop.  For information on the "split" operation, see "split" in perlfunc.

       For  an  excellent  all-around  resource  on  the  care  and feeding of regular expressions, see the book
       MasteringRegularExpressions by Jeffrey Friedl (published by O'Reilly, ISBN 1556592-257-3).

See Also