vcfprimers

       Erik Garrison and vcflib contributors.

vcfprimers (vcflib)                                                                                VCFPRIMERS(1)

       For  each  VCF record, extract the flanking sequences, and write them to stdout as FASTA records suitable
       for alignment.

0      Success

       not0  Failure

       Copyright 2011-2024 (C) Erik Garrison and vcflib contributors.  MIT licensed.   Copyright  2020-2024  (C)
       Pjotr Prins.

vcfprimers

              options:
                  -f, --fasta-reference  FASTA reference file to use to obtain primer sequences
                  -l, --primer-length    The length of the primer sequences on each side of the variant

              This tool is intended for use in designing validation
              experiments.  Primers extracted which would flank all of the alleles at multi-allelic
              sites.  The name of the FASTA "reads" indicates the VCF record which they apply to.
              The form is >CHROM_POS_LEFT for the 3' primer and >CHROM_POS_RIGHT for the 5' primer,
              for example:

              >20_233255_LEFT
              CCATTGTATATATAGACCATAATTTCTTTATCCAATCATCTGTTGATGGA
              >20_233255_RIGHT
              ACTCAGTTGATTCCATACCTTTGCCATCATGAATCATGTTGTAATAAACA

              Type: transformation

vcflib(1)

vcfprimers options