bp_flanks - finding flanking sequences for a variant in a sequence position
Contents
Description
This script allows you to extract a subsequence around a region of interest from an existing sequence.
The output if fasta formatted sequence entry where the header line contains additional information about
the location.
Example
% bp_flanks ~/seq/ar.embl
>1_/HOME/HEIKKI/SEQ/AR.EMBL oripos=100 strand=1 allelepos=100
taataactcagttcttatttgcacctacttcagtggacactgaatttggaaggtggagga
ttttgtttttttcttttaagatctgggcatcttttgaatCtacccttcaagtattaagag
acagactgtgagcctagcagggcagatcttgtccaccgtgtgtcttcttctgcacgagac
tttgaggctgtcagagcgct
Name
bp_flanks - finding flanking sequences for a variant in a sequence position
Options
The script takes one unnamed argument which be either a file name in the local file system or a
nucleotide sequence accession number.
-p Position uses simple nucleotide sequence feature table
--position notation to define the region of interest, typically a
SNP or microsatellite repeat around which the flanks are
defined.
There can be more than one position option or you can
give a comma separated list to one position option.
The format of a position is:
[id:] int | range | in-between [-]
The optional id is the name you want to call the new
sequence. If it not given in joins running number to the
entry name with an underscore.
The position is either a point (e.g. 234), a range (e.g
250..300) or insertion point between nucleotides
(e.g. 234^235)
If the position is not completely within the source
sequence the output sequence will be truncated and it
will print a warning.
The optional hyphen [-] at the end of the position
indicates that that you want the retrieved sequence to be
in the opposite strand.
-f Defaults to 100. This is the length of the nucleotides
--flanklen sequence retrieved on both sides of the given position.
If the source file does not contain
Output Format
The output is a fasta formatted entry where the description file contains tag=value pairs for information
about where in the original sequence the subsequence was taken.
The ID of the fasta entry is the name given at the command line joined by hyphen to the filename or
accesion of the source sequence. If no id is given a series of consecutive integers is used.
The tag=value pairs are:
oripos=int
position in the source file
strand=1|-1
strand of the sequence compared to the source sequence
allelepos=int
position of the region of interest in the current entry. The tag is the same as used by dbSNP@NCBI
The sequence highlights the allele variant position by showing it in upper case and rest of the sequence
in lower case characters.
Synopsis
bp_flanks --position POS [-p POS ...] [--flanklen INT]
accession | filename
Todo
The input files are assumed to be in EMBL format and the sequences are retrieved only from the EMB
database. Make this more generic and use the registry.
head1 FEEDBACK
MailingLists
User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments
and suggestions preferably to the Bioperl mailing lists Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion
http://bioperl.org/wiki/Mailing_lists - About the mailing lists
ReportingBugs
Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution. Bug
reports can be submitted via the web:
https://github.com/bioperl/bioperl-live/issues
