logo
Free, unlimited AI code reviews that run on commit
git-lrc git-lrc GitHub Install Now We'd appreciate a star git-lrc - Free, unlimited AI code reviews that run on commit | Product Hunt git-lrc - Free, unlimited AI code reviews that run on commit | Product Hunt

seqcluster - seqcluster Documentation [image: seqcluster banner] [image]

Author

       Lorena Pantano, Francisco Pantano, Eulalia Marti

Citation

       Please if you use seqcluster make sure to cite the other tools are integrated here:

       A  non-biased  framework  for the annotation and classification of the non-miRNA small RNA transcriptome.
       Pantano   L1,   Estivill   X,   Martí   E.    Bioinformatics.    2011    Nov    15;27(22):3202-3.    doi:
       10.1093/bioinformatics/btr527. Epub 2011 Oct 5. PMID: 21976421

       SeqBuster  is  a  bioinformatic  tool  for  the  processing  and analysis of small RNAs datasets, reveals
       ubiquitous miRNA modifications in human embryonic cells. Pantano L, Estivill X, Martí  E.  Nucleic  Acids
       Res. 2010 Mar;38(5):e34. Epub 2009 Dec 11.

       Quinlan  AR  and  Hall  IM, 2010. BEDTools: a flexible suite of utilities for comparing genomic features.
       Bioinformatics. 26, 6, pp. 841–842.

       Dale RK, Pedersen BS, and Quinlan AR. Pybedtools: a flexible  Python  library  for  manipulating  genomic
       datasets and annotations. Bioinformatics (2011). doi:10.1093/bioinformatics/btr539

       Li  H.*,  Handsaker  B.*, Wysoker A., Fennell T., Ruan J., Homer N., Marth G., Abecasis G., Durbin R. and
       1000 Genome Project Data Processing Subgroup (2009) The Sequence alignment/map (SAM) format and SAMtools.
       Bioinformatics, 25, 2078-9. [PMID: 19505943]

       Li H A statistical framework for SNP calling, mutation  discovery,  association  mapping  and  population
       genetical parameter estimation from sequencing data. Bioinformatics. 2011 Nov 1;27(21):2987-93. Epub 2011
       Sep 8. [PMID: 21903627]

Classes

       Visit GitHub code

       I am in the process to document all classes and methods

       • IndexModuleIndexSearchPage

Collapse Fastq(.Gz) Files

Definition

       Normally quality values are lost in  small RNA-seq pipelines due to collapsing after adapter recognition.
       This option allow to collapse reads after adapter removal with cutadapt or any other tool. This  way  the
       mapping  can use quality values, allowing to map using bwa for instance, or any other alignment tool that
       doesn't support FASTA files.

       Methods

       The new quality values are the average of each of the sequence collapse.

       Example

          seqcluster collapse -f sample_trimmed.fastq -o collapse

       • -f is the fastq(.gz) file

       • -o the folder where the outout will be created. A new FASTQ file, where the name stand for:

            @seq_[0-9]_x[0-9]

       The number right after _x means the abundance of this sequence in the sample

Documentation

Examples Of Small Rna Analysis

miRQCdataAboutmirRQCproject

       samples overview:

       >>  Universal  Human  miRNA  reference  RNA  (Agilent Technologies, #750700), human brain total RNA (Life
       Technologies, #AM6050), human liver total RNA (Life Technologies,  #AM7960)  and  MS2-phage  RNA  (Roche,
       #10165948001)  were diluted to a platform-specific concentration. RNA integrity and purity were evaluated
       using the Experion automated gel electrophoresis system (Bio-Rad) and Nanodrop spectrophotometer. All RNA
       samples were of high quality (miRQC A: RNA quality index (RQI, scale from 0 to 10) = 9.0; miRQC B: RQI  =
       8.7;  human  liver RNA: RQI = 9.2) and high purity (data not shown). RNA was isolated from serum prepared
       from three healthy  donors  using  the  miRNeasy  mini  kit  (Qiagen)  according  to  the  manufacturer's
       instructions,  and  RNA  samples  were  pooled.  Informed  consent  was  obtained  from all donors (Ghent
       University Ethical Committee). Different kits for isolation of serum RNA are available; addressing  their
       impact  was  outside  the scope of this work. Synthetic miRNA templates for let-7a-5p, let-7b-5p, let-7c,
       let-7d-5p, miR-302a-3p, miR-302b-3p, miR-302c-3p, miR-302d-3p, miR-133a and miR-10a-5p  were  synthesized
       by Integrated DNA Technologies and 5′ phosphorylated. Synthetic let-7 and miR-302 miRNAs were spiked into
       MS2-phage  RNA  and  total  human liver RNA, respectively, at 5 × 106 copies/μg RNA. These samples do not
       contain endogenous miR-302 or let-7 miRNAs, which allowed unbiased analysis of  cross-reactivity  between
       the  individual  miR-302  and  let-7  miRNAs measured by the platform and the different miR-302 and let-7
       synthetic templates in a complex RNA background. Synthetic miRNA  templates  for  miR-10a-5p,  let-7a-5p,
       miR-302a-3p  and miR-133a were spiked in human serum RNA at 6 × 103 copies per microliter of serum RNA or
       at 5-times higher, 2-times higher, 2-times lower and  5-times  lower  concentrations,  respectively.  All
       vendors received 10 μl of each serum RNA sample.

       Commands

       Data  was  download  from GEO web with this script. The following 2 configs were used for the two sets: ‐
       mirqcsamples  and nonmirqcsamples. Samples were analyzed with bcbio with the following commandsreport

       Report showing part of the output report of bcbio pipelines together with some validations are here.

Getting Started

       Best practices are implemented in a pythonframework.

   clusteringofsmallRNAsequences
       seqcluster  generates  a list of clusters of small RNA sequences, their genome location, their annotation
       and the abundance in all the sample of the project [image]

       REMOVEADAPTER

       I am currently using cutadapt:

          cutadapt --adapter=$ADAPTER --minimum-length=8 --untrimmed-output=sample1_notfound.fastq -o sample1_clean.fastq -m 17 --overlap=8 sample1.fastq

       COLLAPSEREADS

       To reduce computational time, I recommend to collapse sequences, also it  would  help  to  apply  filters
       based on abundances.  Like removing sequences that appear only once.

          seqcluster collapse -f sample1_clean.fastq -o collapse

       Here I am only using sequences that had the adapter, meaning that for sure are small fragments.

       This  is  compatible  with  UMI  barcodes. If you have in the read name UMI_ATCGAT``,thenthetoolwillremovePCRdupiclatesaswell.Toconfirmthishappened,thetoolshouldoutputthissentenceduringtheprocessingofthefile:``FindUMItagsinreadnames,collapsingbyUMI.

       PREPARESAMPLES

          seqcluster prepare -c file_w_samples -o res --minl 17 --minc 2 --maxl 45

       the file_w_samples should have the following format:

          lane1_sequence.txt_1_1_phred.fastq      cc1
          lane1_sequence.txt_2_1_phred.fastq      cc2
          lane2_sequence.txt_1_1_phred.fastq      cc3
          lane2_sequence.txt_2_1_phred.fastq      cc4

       two  columns  file,  where the first column is the name of the file with the small RNA sequences for each
       sample, and the second column in the name of the sample.

       The fastq files should be like this:

          @seq_1_x11
          CCCCGTTCCCCCCTCCTCC
          +
          QUALITY_LINE
          @seq_2_x20
          TGCGCAGTGGCAGTATCGTAGCCAATG
          +
          QUALITY_LINE
          </pre>

       Where _x[09]  indicate the abundance of that sequence,  and  the  middle  number  is  the  index  of  the
       sequence.

       This  script will generate: seqs.fastq and seqs.ma.  * seqs.fastq: have unique sequences and unique ids *
       seqs.ma: is the abundance matrix of all unique sequences in all samples

       ALIGNMENT

       You should use an aligner to map seqs.fa to your genome. A possibility is bowtie or STAR.  From here,  we
       need a file in BAM format for the next step.  VERY IMPORTANT: the BAM file should be sorted

          bowtie -a --best --strata -m 5000 INDEX seqs.fastq -S | samtools view -Sbh /dev/stdin | samtools sort -o /dev/stdout temp > seqs.sort.bam

       or

          STAR --genomeDir $star_index_folder --readFilesIn res/seqs.fastq --alignIntronMax 1  --outFilterMultimapNmax 1000 --outSAMattributes NH HI NM --outSAMtype BAM SortedByCoordinate

       CLUSTERING

          seqcluster cluster -a res/Aligned.sortedByCoord.out.bam  -m res/seqs.ma -g $GTF_FILE  -o res/cluster -ref PATH_TO_GENOME_FASTA --db example

       • -a is the SAM file generated after mapped with your tool, which input has been seqs.fa

       • -m the previous seqs.fa

       • -b annotation files in bed format (see below examples) [deprecated]

       • -g annotation files in gtf format (see below examples) [recommended]

       • -i genome fasta file used in the mapping step (only needed if -s active)

       • -o output folder

       • -ref genome fasta file. Needs fai file as well there. (i.e hg19.fa, hg19.fa.fai)

       • -d create debug logging

       • -s construction of putative precursor (NOT YET IMPLEMENTED)

       • --db  (optional)  will  create sqlite3 database with results that will be used to browse data with html
         web page (under development)

       Example of a bed file for annotation (the fourth column should be the name of the feature):

          chr1    157783  157886  snRNA   0       -

       Strongly recommend gtf format. Bed annotation is deprecated. Go here to know how to  download  data  from
       hg19 and mm10.

       Example  of  a  gtf file for annotation (the third column should be the name of the feature and the value
       after genename attribute is the specific annotation):

          chr1    source  miRNA      1       11503   .       +       .       gene name 'mir-102' ;

       hint: scripts to generate human and mouse annotation are inside seqcluster/scripts folder.

       OUTPUTScounts.tsv: count matrix that can be input of downstream analyses

       • size_counts.tsv: size distribution of the small RNA by annotation group

       • seqcluster.json: json file containing all information

       • log/run.log: all messages at debug level

       • log/trace.log: to keep trace of algorithm decisions

   InteractiveHTMLReport
       This will create html report using the following command assuming the output of seqclustercluster is  at
       res:

          seqcluster report -j res/seqcluster.json -o report -r $GENONE_FASTA_PATH

       where $GENOME_FASTA_PATH is the path to the genome fasta file used in the alignment.

       Note: you can try our new visualizationtool!

       • report/html/index.html: table with all clusters and the annotation with sorting option

       • report/html/[0-9]/maps.html:  summary  of  the  cluster  with  expression  profile, annotation, and all
         sequences inside

       • report/html/[0-9]/maps.fa: putative precursor

       An example of the output is below: [image]

   Easystartwithbcbio-nextgen.pyNote:If you already are using bcbio, visit bcbio to run the pipeline there.

       To install the small RNA data:

          bcbio_nextgen.py upgrade -u development --tools --datatarget smallrna

       Optionstoruninacluster

       It uses ipython-cluster-helper to send jobs to nodes in the cluster

       • --parallel should set to ipython--scheduler should be set to sge,lsf,slurm--num-jobs indicates how much jobs to launch. It will run samples independently. If you have 4 samples,
         and set this to 4, 4 jobs will be launch to the cluster

       • --queue the queue to use

       • --resources allows to set any special parameter  for  the  cluster,  such  as,  email  in  sge  system:
         M=my@email.com

       Read complete usability here: https://github.com/roryk/ipython-cluster-helper An examples in slurm system
       is:

          --parallel ipython --scheduler slurm --num-jobs 4 --queue general

       Output

       • one folder for each analysys, and inside one per sample

          • adapter:  *clean.fastq  is  the  file  after  adapter  removal, *clean_trimmed.fastq is the collapse
            clean.fastq, *fragments.fastq is file without adapter, *short.fastq is file with reads < 16 nt.

          • align: BAM file results from align trimmed.fastq

          • mirbase: file with miRNA anotation and novel miRNA discovery with mirdeep2

          • tRNA: analysis done with tdrmapper [citation needed]

          • qc: *_fastqc.html is the fastqc results from the uncollapse fastq file

       • seqcluster: is the result of running seqcluster. See its documentation for further information.

       • report/srna-report.Rmd: template to create a  quick  html  report  with  exploration  and  differential
         expression analysis. See examplehere

Handling Multi-Mapped Reads

Definition

       multi-mapped reads are the sequences that map more than one time on the  genome,  for  instance,  because
       there are multiple copies of a gene, like happens with tRNA precursors

       Consequence

       Many  pipelines ignores these sequences as defaults, what means that you are losing at leas 20-30% of the
       data. In this case is difficult to decide where these sequences come from and currently there  are  three
       strategies:

       • ignore them

       • count  as many times as they appear: for instance, if a sequences map twice, just count it two times in
         the two loci. This will due an over-representation of the loci abundances, and actually is against  the
         assumption of all packages that perform differential expression in count data.

       • weight them: divide the total count by the number of places it maps. In the previous example, each loci
         would  get  1/2 * count. This produces weird dispersion values for packages that fit this value as part
         of the model.

       Ourimplementation [image]

       We try to decide the origin of these sequences. The most common scenario is that a group of sequences map
       two three different regions, probably due to multi-copies on the genome of the precursor.

       We introduce two options:

       • most-voting strategy: In this case, we just count once all sequences, and we output this like one  unit
         of transcription with multiple regions. This is the option by default.

       • bayes  inference:  we give the same prior probability to all locations, and use the number of sequences
         starting in the same position than the one we are trying to predict its location as P(B|A).  With  this
         we  calculate  the  posterior  that  will  be  used  to  get  the proportion of counts to the different
         locations. We apply the code from the book: "Think Bayes" ( Allen  B.  Downey).  This  is  still  under
         development. To activate this option, the user just needs to add --methodbabes

       The  main advantage of this, it is that it can be the input of any downstream analysis that is applied to
       RNA-seq, like DESeq, edgeR ... As well, there is less noise, because there is only one output coming from
       here, not three.

Installation

SeqclusterWithbcbioinstalled

       If you already have
       `bcbio`_
       , seqcluster comes with it. If you want the last development version:

          /bcbio_anaconda_bin_path/seqcluster_install.py --upgrade

       Docker:

          docker pull lpantano/smallsrna

       Biocondabinary

       install conda if you want an isolate env:

          wget http://repo.continuum.io/miniconda/Miniconda-latest-Linux-x86_64.sh
          bash Miniconda-latest-Linux-x86_64.sh -b -p ~/install/seqcluster/anaconda

       You can install directly from binstar (only for linux):

          ~/install/seqcluster/anaconda/conda install seqcluster seqbuster bedtools samtools pip nose numpy scipy pandas pyvcf -c bioconda

       With  that  you will have everything you need for the python package.  The last step is to add seqcluster
       to your PATH if conda is not already there.

       Go to Tools dependecies below to continue with the installation.

       Note: After installation is highly recommended to get the last updated version doing:

          seqcluster_install.py --upgrade

       automatedinstallation

       Strongly recommended to use bcbio installation if you work with  sequencing  data.  But  if  you  want  a
       minimal installation:

          pip install fabric
          seqcluster_install --upgrade
          mkdir -p $PATH_TO_TOOLS/bin
          seqcluster_install --tools $PATH_TO_TOOLS

       After that you will need to add to your path: exportPATH=$PATH_TO_TOOLS/bin:$PATHToolsdependeciesforafullsmallRNApipeline
       For seqcluster command:

       • bedtools

       • samtools

       • rnafold (for HTML report)

       For some steps of a typical small RNA-seq pipeline (recommended to use directly
       `bcbio`_
        ):

       • STAR, bowtie

       • fastqc

       • cutadapt (install with bioconda using the same python env than seqcluster.

       You will need to link the cutadapt binary to your PATH)

   Data
       Easy  way  to install your small RNA seq data with cloudbiolinux.  Seqcluster has snipped code to do that
       for you. Recommended to use
       `bcbio`_
        for the pipeline since will install everything you need in a single  step  bcbio_nextgen.pyupgrade-udevelopment--tools--genomeshg19--alignersbowtie.

       But  If you want to run seqcluster step by step an example of hg19 human version it will be (another well
       annotated supported genome is mm10):

       Download genome data:

          seqcluster_install --data $PATH_TO_DATA --genomes hg19 --aligners bowtie2 --datatarget smallrna

       If you want to install STAR indexes since gets kind of better results than bowtie2 (warning, 40GB  memory
       RAM needed):

          seqcluster_install --data $PATH_TO_DATA --genomes hg19 --aligners star

   Rpackage
       Install isomiRs package for R using devtools:

          devtools::install_github('lpantano/isomiRs')

       To install all packages used by the Rmd report:

          Rscript -e 'source(https://raw.githubusercontent.com/lpantano/seqcluster/master/scripts/install_libraries.R)'

Mirna Annotation

       miRNA annotation is running inside bcbiosmallRNAseqpipeline together with other tools to do a complete
       small RNA analysis.

       For some comparison with other tools go here.

       You can run samples after processing the reads as shown below.  Currently there are two version: JAVA

       Naming

       See always up to date information here in mirtopopenproject.

       It is a working process, but since 10-21-2015 isomiR naming has changed to:

       • Nucleotide substitution: NUMBER|NUCLEOTIDE_ISOMIR|NUCLEOTIDE_REFERENCE means at the position giving  by
         the  number  the  nucleotide  in the sequence has substituted the nucleotide in the reference. This, as
         well, is a post-transcriptional modification.

       • Additions at 3' end: 0/NA means no modification. UPPERCASELETTER means  addition  at  the  end.  Note
         these nucleotides don't match the precursor. So they are post-transcriptional modification.

       • Changes  at 5' end: 0/NA means no modification. UPPERCASELETTER means nucleotide insertions (sequence
         starts before miRBase mature position). LOWWERCASELETTER means nucleotide deletions (sequence  starts
         after miRBase mature position).

       • Changes  at 3' end: 0/NA means no modification. UPPERCASELETTER means nucleotide insertions (sequence
         ends after miRBase mature position). LOWWERCASELETTER  means  nucleotide  deletions  (sequence  ends
         before miRBase mature position).

   ProcessingofreadsREMOVEADAPTER

       I am currently using cutadapt.

          cutadapt --adapter=$ADAPTER --minimum-length=8 --untrimmed-output=sample1_notfound.fastq -o sample1_clean.fastq -m 17 --overlap=8 sample1.fastq

       COLLAPSEREADS

       To  reduce  computational  time,  I  recommend to collapse sequences, also it would help to apply filters
       based on abundances.  Like removing sequences that appear only once.

          seqcluster collapse -f sample1_clean.fastq -o collapse

       Here I am only using sequences that had the adapter, meaning that  for  sure  are  small  fragments.  The
       output will be named as sample1_clean_trimmed.fastqPreparedatabases
       For  human  or mouse, follows thisinstruction to download easily miRBase files. In general you only need
       hairpin.fa and miRNA.str from miRBase site. mirGeneDB is also supported, download the needed files here.

       Highlyrecommendedtofilterhairpin.fatocontainonlythedesiredspecies.miRNA/isomiRannotationwithJAVAMIRALIGNER

       Download the tool from miraligner repository.

       Download the mirbase files (hairpin and miRNA) from the ftp and save it to DB folder.

       You can map the miRNAs with.

          java -jar miraligner.jar -sub 1 -trim 3 -add 3 -s hsa -i sample1_clean_trimmed.fastq -db DB  -o output_prefix

       Cite

       SeqBuster is a bioinformatic tool for the  processing  and  analysis  of  small  RNAs  datasets,  reveals
       ubiquitous  miRNA  modifications  in human embryonic cells. Pantano L, Estivill X, Martí E. NucleicAcidsRes.2010Mar;38(5):e34.Epub2009Dec11.NOTE:Checkcomparisonofmultipletools for miRNA annotation.

   ConverttoGFF3-srna
       Use mirtop to convert to GFF3-srna format. This is the desired format to share the isomiR information and
       can be used to join multiple projects together easily.

       See  to know how to convert all the output into a single file and share easily with collaborators:

          mirtop gff --format seqbuster --sps hsa --hairpin database/hairpin.fa --gtf database/hsa.gff3 -o test_out out_folder/*/*.mirna

   Post-analysiswithR
       Use the outputs to do differential expression, clustering and descriptive analysis with this  package:  ‐
       isomiRs

       To  load  the  data  you can use IsomirDataSeqFromFilesfunction and get the count data with isoCounts to
       move to DESeq2 or similar packages.

   Manualofmiraligner(JAVA)options

       Add -freq if you have your fasta/fastq file with this format  and  you  want  a  third  column  with  the
       frequency (normally value after x character):

          >seq_1_x4
          CACCGCTGTCGGGGAACCGCGCCAATTT

       Add -pre if you want also sequences that map to the precursor but outside the mature miRNA

       • Parameter -sub: mismatches allowed (0/1)

       • Parameter -trim: nucleotides allowed for trimming (max 3)

       • Parameter -add: nucleotides allowed for addition (max 3)

       • Parameter -s: species (3 letter, human=>hsa)

       • Parameter -i: fasta file

       • Parameter -db: folder where miRBase files are(one copy at miraligner-1.0/DB folder)

       • Parameter -o: prefix for the output files

       • Parameter  -freq: add frequency of the sequence to the output (just where input is fasta file with name
         matching this patter: >seq_3_x67)

       • Parameter -pre: add sequences mapping to precursors as well

       input

       A fasta/fastq file reads:

          >seq
          CACCGCTGTCGGGGAACCGCGCCAATTT

       or tabular file with counts information:

       CACCGCTGTCGGGGAACCGCGCCAATTT 45

       output

       Track file
       *
       .mirna.opt: information about the process

       Non mapped sequences will be on
       *
       .nomap

       Header of the
       *
       .mirna.out file:

       • seq: sequence

       • freq/name: depending on the input this column contains counts (tabular input file) or name (fasta file)

       • mir: miRNA name

       • start: start of the sequence at the precursor

       • end: end of the sequence at the precursor

       • mism: nucleotide substitution position | nucleotide at sequence | nucleotide at precursor

       • addition: nucleotides at 3 end added:

            precursor         => cctgtggttagctggttgcatatcc
            annotated miRNA   =>   TGTGGTTAGCTGGTTGCATAT
            sequence add:  TT =>   TGTGGTTAGCTGGTTGCATATTT

       • tr5: nucleotides at 5 end different from the annonated sequence in miRBase:

            precursor             => cctgtggttagctggttgcatatcc
            annotated miRNA   =>   TGTGGTTAGCTGGTTGCATAT
            sequence tr5:  CC => CCTGTGGTTAGCTGGTTGCATAT
            sequence tr5:  tg =>     TGGTTAGCTGGTTGCATAT

       • tr3: nucleotides at 3 end different from the annotated sequence in miRBase:

            precursor         => cctgtggttagctggttgcatatcc
            annotated miRNA   =>   TGTGGTTAGCTGGTTGCATAT
            sequence tr3: cc  =>   TGTGGTTAGCTGGTTGCATATCC
            sequence tr3: AT  =>   TGTGGTTAGCTGGTTGCAT

       • s5: offset nucleotides at the begining of the annotated miRNAs:

            precursor         => agcctgtggttagctggttgcatatcc
            annotated miRNA   =>     TGTGGTTAGCTGGTTGCATAT
            s5                => AGCCTGTG

       • s3:offset nucleotides at the ending of the annotated miRNAs:

            precursor         =>  cctgtggttagctggttgcatatccgc
            annotated miRNA   =>    TGTGGTTAGCTGGTTGCATAT
            s3                =>                     ATATCCGC

       • type: mapped on precursor or miRNA sequences

       • ambiguity: number of different detected precursors

       Example:

          seq                 miRNA           start   end     mism    tr5     tr3     add     s5      s3      DB amb
          TGGCTCAGTTCAGCAGGACC    hsa-mir-24-2    50      67      0       qCC     0       0       0       0       precursor 1
          ACTGCCCTAAGTGCTCCTTCTG  hsa-miR-18a*    47      68      0       0       0       tG      ATCTACTG        CTGGCA  miRNA 1

Name

       seqcluster - seqcluster Documentation [image: seqcluster banner] [image]

       Analysis of small RNA sequencing data. It detect unit of transcription over the genome, annotate them and
       create an HTML interactive report that helps to explore the data quickly.

       Contents:

Outputs

seqclustercounts.tsv:  count  matrix  that  can  be input of downstream analyses. nloci will be 0 always that the
         meta-cluster has been resolved successfully. For instance, it can happen that  you  got  sequences  you
         have  a  bunch  of  sequences  mapping  to  hundreds of different places on the genome, then seqcluster
         doesn’t resolve that, and put everything under the  larger  region  covered  by  those  sequences.  So,
         mainly, 0 all are good rows. The ann column is just where the meta-clusters overlap with. It can happen
         that  one name appears many times if different locations of the meta-cluster map to different copies of
         that feature. OR if the annotation file used had multiple lines for that.

       • read_stats.tsv: number of reads for each sample after each step in the analysis. Meant to give  a  hint
         if we lose a lot of information or not.

       • size_counts.tsv: size distribution of the small RNA by annotation group. (position, reads, cluster)

       • seqcluster.json:  json  file  containing  all information. This file is used as the input of the report
         suit.

       • log/run.log: all messages at debug level

       • log/trace.log: to keep trace of algorithm decisions

   Report
       Beside the static HTML report that you can get using reportsubcommand,  you  can  download  this  HTML.
       (watch the repository to get notifications of new releases.)

       • Go inside seqclusterViz folder

       • Open reader.html

       • Upload the seqcluster.db file generated by report subcommand.

       • Start browsing your data!

       Meaning of different sections:

       • Top-left table shows list of meta-clusters, user can filter by number ID or keywords.

       • Top-right table shows positions where this meta-cluster has been detected.

       • Expression  profile along precursor: Lines are number of reads in that position of the precursor. It is
         sum of the log2 RPM of the expression for each sample.

       • Table: raw counts for each sample and sequence. Only top 100 are shown.

       • secondary structure: The region with more sequences inside meta-cluster is used to plot  the  secondary
         structure. Colors refers to abundance in each position. Darker means more abundance.

       An example of the HTML code:  _ ..examples

Relevant Papers About Isomirs And Other Novel Small Rnas With Functional Relevance

ValidationOurapproach can be  adapted  to  many  polyadenylation-based  RT-qPCR  technologies  already  exiting,
         providing a convenient way to distinguish long and short 3′-isomiRs.

   IsomiRsNaturallyexistingisoformsofmiR-222havedistinctfunctions: this work demonstrates the capacity for
       3' isomiRs to mediate differential functions, we contend more attention needs to be given to 3'  variance
       given the prevalence of this class of isomiR.

       miR-142-3pisomiR:   "We  furthermore  demonstrate  that  miRNA  5′-end  variation leads to differential
       targeting and can thus broaden the target range of miRNAs."

       A highly expressed miR-101isomiR is a functional silencing small RNA.

       A challenge for miRNA: multiple isomiRs in miRNAomics.miR-183-5pisomiRchangesinbreastcancer. Validated target regulation of new genes different  from  the
       reference miRNA.

       Acomprehensivesurveyof3'animalmiRNAmodification events and a possible role for 3' adenylation in
       modulating miRNA targeting effectiveness.

       PAPD5-mediated 3′ adenylation and subsequent degradation of miR-21 is disrupted in proliferative disease.

       High-resolution analysis of the human retina miRNome reveals isomiR variations and novel microRNAs.

       Sequence features of Drosha and Dicer cleavage sites affect the complexityofisomiRs.

       Knowledge about the presence or absence of miRNA isoforms (isomiRs) can successfully discriminate amongst
       32 TCGAcancertypesGeneralAnovelpiRNAmechanism in regulating gene expression in highly differentiated somatic cells.

       DifferentialandcoherentprocessingpatternsfromsmallRNAs to detect changes in profiles of processing
       small RNAs.

       Survey of 800+ datasets from human tissue and body fluid reveals XenomiRsarelikelyartifactsTargetsIdentificationoffactors involved in target RNA-directed microRNA degradation.

   TechonolgymiRQC: work studying the accuracy and specificity of different technologies to detect miRNAs.

       ImportantfeaturesaffectingthedetectionofsmallRNAbiomarkers:  How  the  sample  can  affect  the
       detection of biomarkers (like RIN value, concentration, ...)

       Comparisonofalignmentandnormalization . I will take the message that TMM and DESeq/2 normalization
       are the best to avoid strong bias if we consider to have  a  small  proportion  of  DE  miRNAs.  For  the
       alignments,     here     you     have     another     comparison     for     miRNAs     annotation:     ‐
       https://rawgit.com/lpantano/tools-mixer/master/mirna/mirannotation/stats.htmlreviewoftoolsfordetectmiRNA-diseasenetwork.

       reviewoftools  for miRNA de-novo and interaction analysis

       EvaluationofmicroRNAalignmenttechniques BIG meeting on Dec,3 2015: bcbio-srnaseq-BIG-20151203.pdf

Tools For Downstream Analysis

Web-serversTFmiR: disease-specific miRNA/transcription factor co-regulatory networks  v1.2.  It  uses  results  from
       UP/DOWN  regulated  miRNA/Genes  and  allows  to  focus  in  only one disease to create different type of
       relationships between miRNA/TF/Gene. Easy to use. Probably need to filter the output sometime due to  the
       big networks that can result from an analysis.

       Diana-TarBasev7.0:  Database for validated miRNA targets. Many filter options. Good for small candidate
       miRNAs set studies.

       StarScan: Database to browse the targets of miRNAs from degradome data. It has  a  fancy  interface,  and
       many species and data from GEO.

       miRtex  gives targets from literature. Good for finding validated targets to help discussion in papers or
       further functional experiment based on new hypothesis.

       piRBase: Database for piRNA annotation and function. Published last year, for now the best I can find out
       there.

       chimira: Web tool to analyze isomiR. It gives you a quick idea of you samples.

       MicroCosm: MiRNA target database. Updated and download option.

       IsomiRBank: isomiR database from many species and tissues. For single queries is useful.

   Command-linesmiRVaS : tools to predict the functional changed due to nt changes in the miRNA sequence.

See Also