logo
Free, unlimited AI code reviews that run on commit
git-lrc git-lrc GitHub Install Now We'd appreciate a star git-lrc - Free, unlimited AI code reviews that run on commit | Product Hunt git-lrc - Free, unlimited AI code reviews that run on commit | Product Hunt

trf - locate and display tandem repeats in DNA sequences

Author

       Copyright © 1999-2020 Gary Benson

       This manpage was written by Andreas Tille for the Debian distribution and can be used for any other usage
       of the program.

trf 4.09.1                                          June 2020                                             TRF(1)

Name

       trf - locate and display tandem repeats in DNA sequences

Note

       Note the sequence file should be in FASTA format:

       >Name          of          sequence          aggaaacctgccatggcctcctggtgagctgtcctcatccactgctcgctgcctctccag
       atactctgacccatggatcccctgggtgcagccaagccacaatggccatggcgccgctgt
       actcccacccgccccaccctcctgatcctgctatggacatggcctttccacatccctgtg

Options

       Where: (all weights, penalties, and scores are positive)

       File   sequences input file

       Match  matching weight

       Mismatch
              mismatching penalty

       Delta  indel penalty

       PM     match probability (whole number)

       PI     indel probability (whole number)

       Minscore
              minimum alignment score to report

       MaxPeriod
              maximum period size to report

   [options]=oneormoreofthefollowing:-m     masked sequence file

       -f     flanking sequence

       -d     data file

       -h     suppress html output

       -r     no redundancy elimination

       -l <n> maximum  TR length expected (in millions) (eg, -l 3 or -l=3 for 3 million) Human genome HG38 would
              need -l 6

       -ngs   more compact .dat output on multisequence files, returns 0 on success.  Output is printed  to  the
              screen,  not a file. You may pipe input in with this option using - for file name. Short 50 flanks
              are appended to .dat output.

See Also

       See more information on the TRF Unix Help web page: https://tandem.bu.edu/trf/trf.unix.help.html

Synopsis

trf (File|Match|Mismatch|Delta|PM|PI|Minscore|MaxPeriod) [options]

See Also