gt-fingerprint - Compute MD5 fingerprints for each sequence given in a set of sequence files.
Contents
Description
-check [filename]
compare all fingerprints contained in the given checklist file with checksums in given
sequence_files(s). The comparison is successful, if all fingerprints given in checkfile can be found
in the sequence_file(s) in the exact same quantity and vice versa. (default: undefined)
-duplicates [yes|no]
show duplicate fingerprints from given sequence_file(s). (default: no)
-extract [string]
extract the sequence(s) with the given fingerprint from sequence file(s) and show them on stdout.
(default: undefined)
-width [value]
set output width for FASTA sequence printing (0 disables formatting) (default: 0)
-o [filename]
redirect output to specified file (default: undefined)
-gzip [yes|no]
write gzip compressed output file (default: no)
-bzip2 [yes|no]
write bzip2 compressed output file (default: no)
-force [yes|no]
force writing to output file (default: no)
-help
display help and exit
-version
display version information and exit
If neither option -check nor option -duplicates is used, the fingerprints for all sequences are shown on
stdout.
Fingerprint of a sequence is case insensitive. Thus MD5 fingerprint of two identical sequences will be
the same even if one is soft-masked.
Examples
Compute (unified) list of fingerprints:
$ gt fingerprint U89959_ests.fas | sort | uniq > U89959_ests.checklist_uniq
Compare fingerprints:
$ gt fingerprint -check U89959_ests.checklist_uniq U89959_ests.fas
950b7715ab6cc030a8c810a0dba2dd33 only in sequence_file(s)
Make sure a sequence file contains no duplicates (not the case here):
$ gt fingerprint -duplicates U89959_ests.fas
950b7715ab6cc030a8c810a0dba2dd33 2
gt fingerprint: error: duplicates found: 1 out of 200 (0.500%)
Extract sequence with given fingerprint:
$ gt fingerprint -extract 6d3b4b9db4531cda588528f2c69c0a57 U89959_ests.fas
>SQ;8720010
TTTTTTTTTTTTTTTTTCCTGACAAAACCCCAAGACTCAATTTAATCAATCCTCAAATTTACATGATAC
CAACGTAATGGGAGCTTAAAAATA
Name
gt-fingerprint - Compute MD5 fingerprints for each sequence given in a set of sequence files.
Reporting Bugs
Report bugs to https://github.com/genometools/genometools/issues.
GenomeTools 1.6.5 04/27/2024 GT-FINGERPRINT(1)
Return Values
• 0 everything went fine (-check: the comparison was successful; -duplicates: no duplicates found)
• 1 an error occurred (-check: the comparison was not successful; -duplicates: duplicates found)
Synopsis
gtfingerprint [option ...] sequence_file [...]
