Bio::Seq::PrimedSeq - A sequence and a pair of primers matching on it
Contents
Appendix
The rest of the documentation details each of the object methods. Internal methods are usually preceded
with a _
new
Title : new()
Usage : my $primedseq = Bio::SeqFeature::Primer->new(
-seq => $sequence,
-left_primer => $left_primer,
-right_primer => $right_primer
);
Function: Construct a primed sequence.
Returns : A Bio::Seq::PrimedSeq object
Args : -seq => a Bio::Seq object (required)
-left_primer => a Bio::SeqFeature::Primer or sequence object (required)
-right_primer => a Bio::SeqFeature::Primer or sequence object (required)
If you pass a sequence object to specify a primer, it will be used to
construct a Bio::SeqFeature::Primer that you can retrieve with the
L<get_primer> method.
Many other parameters can be included including all of the output
parameters from the primer3 program (see L<Bio::Tools::Primer3>). At
the moment these parameters will simply be stored and do anything.
get_primer
Title : get_primer();
Usage : my @primers = $primedseq->get_primer();
or
my $primer = $primedseq->get_primer('-left_primer');
Function: Get the primers associated with the PrimedSeq object.
Returns : A Bio::SeqFeature::Primer object
Args : For the left primer, use: l, left, left_primer or -left_primer
For the right primer, use: r, right, right_primer or -right_primer
For both primers [default], use: b, both, both_primers or -both_primers
annotated_sequence
Title : annotated_sequence
Usage : my $annotated_sequence_object = $primedseq->annotate_sequence();
Function: Get an annotated sequence object containing the left and right
primers
Returns : An annotated sequence object or 0 if not defined.
Args :
Note : Use this method to return a sequence object that you can write
out (e.g. in GenBank format). See the example above.
amplicon
Title : amplicon
Usage : my $amplicon = $primedseq->amplicon();
Function: Retrieve the amplicon as a sequence object. The amplicon sequnce is
only the section of the target sequence between the primer matches
(primers included).
Returns : A Bio::Seq object. To get the sequence use $amplicon->seq
Args : None
Note :
seq
Title : seq
Usage : my $seqobj = $primedseq->seq();
Function: Retrieve the target sequence as a sequence object
Returns : A seq object. To get the sequence use $seqobj->seq
Args : None
Note :
_place_primers
Title : _place_primers
Usage : $self->_place_primers();
Function: An internal method to place the primers on the sequence and
set up the ranges of the sequences
Returns : Nothing
Args : None
Note : Internal use only
perl v5.32.1 2021-08-15 Bio::Seq::PrimedSeq(3pm)
Description
This module was created to address the fact that a primer is more than a SeqFeature and that there is a
need to represent the primer-sequence complex and the attributes that are associated with the complex.
A PrimedSeq object is initialized with a target sequence and two primers. The location of the primers on
the target sequence is calculated if needed so that one can then get the PCR product, or amplicon
sequence. From the PrimedSeq object you can also retrieve information about melting temperatures and what
not on each of the primers and the amplicon. The Bio::Tools::Primer3 module uses PrimedSeq objects
extensively.
Note that this module does not simulate PCR. It assumes that the primers will match in a single location
on the target sequence and does not understand degenerate primers.
• Providing primers as sequence objects
If the primers are specified as sequence objects, e.g. Bio::PrimarySeq or Bio::Seq, they are first
converted to Bio::SeqFeature::Primer objects. Their location on the target sequence is then
calculated and added to the Bio::SeqFeature::Primer objects, which you can retrieve using the
get_primer() method.
• Providing primers as primer objects
Because of the limitations of specifying primers as sequence objects, the recommended method is to
provide Bio::SeqFeature::Primer objects. If you did not record the location of the primers in the
primer object, it will be calculated.
Bio::Seq::PrimedSeq was initially started by Chad Matsalla, and later improved on by Rob Edwards.
Feedback
User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments
and suggestions preferably to one of the Bioperl mailing lists. Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion
http://bioperl.org/wiki/Mailing_lists - About the mailing lists
Support
Please direct usage questions or support issues to the mailing list:
bioperl-l@bioperl.org
rather than to the module maintainer directly. Many experienced and reponsive experts will be able look
at the problem and quickly address it. Please include a thorough description of the problem with code and
data examples if at all possible.
ReportingBugs
Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution. Bug
reports can be submitted via the web:
https://github.com/bioperl/bioperl-live/issues
Name
Bio::Seq::PrimedSeq - A sequence and a pair of primers matching on it
Recipes
1. Run Primer3 to get PrimedSeq objects:
use Bio::SeqIO;
use Bio::Tools::Run::Primer3;
# Read a target sequences from a FASTA file
my $file = shift || die "Need a file to read";
my $seqin = Bio::SeqIO->new(-file => $file);
my $seq = $seqin->next_seq;
# Use Primer3 to design some primers
my $primer3 = Bio::Tools::Run::Primer3->new(-seq => $seq);
my $results = $primer3->run; # default parameters
# Write all the results in a Genbank file
my $seqout = Bio::SeqIO->new(-file => ">primed_sequence.gbk",
-format => 'genbank');
while (my $primedseq = $results->next_primer) {
$seqout->write_seq( $primedseq->annotated_seq );
}
2. Create a genbank file for a sequence and its cognate primers:
use Bio::SeqIO;
use Bio::Seq::PrimedSeq;
# Read a FASTA file that contains the target sequence and its two primers
my $file = shift || die "$0 <file>";
my $seqin = Bio::SeqIO->new(-file => $file);
my ($template, $leftprimer, $rightprimer) =
($seqin->next_seq, $seqin->next_seq, $seqin->next_seq);
# Set up a PrimedSeq object
my $primedseq = Bio::Seq::PrimedSeq->new(-seq => $template,
-left_primer => $leftprimer,
-right_primer => $rightprimer);
# Write the sequences in an output Genbank file
my $seqout = Bio::SeqIO->new(-file => ">primed_sequence.gbk",
-format => 'genbank');
$seqout->write_seq($primedseq->annotated_sequence);
Synopsis
use Bio::Seq;
use Bio::Seq::PrimedSeq;
my $template = Bio::Seq->new( -seq => 'AGCTTTTCATTCTGACTGCAAC' );
my $left = Bio::Seq->new( -seq => 'AGCT' );
my $right = Bio::Seq->new( -seq => 'GTTGC' );
my $primedseq = Bio::Seq::PrimedSeq->new(
-seq => $template, # sequence object
-left_primer => $left, # sequence or primer object
-right_primer => $right # sequence or primer object
);
# Get the primers as Bio::SeqFeature::Primer objects
my @primer_objects = $primedseq->get_primer();
# Sequence object representing the PCR product, i.e. the section of the target
# sequence contained between the primers (primers included)
my $amplicon_seq = $primedseq->amplicon();
print 'Got amplicon sequence: '.$amplicon_seq->seq."\n";
# Amplicon should be: agctTTTCATTCTGACTgcaac
